Answer:
false false false false false false
The magnetosphere interacts with solar flares. It helps to redirect them. Otherwise, the Earth would be greatly heated and human life would become much harder to sustain, as homeostasis would require better cooling mechanisms.
Mechanical digestion is the breaking down of food into smaller pieces physically. Mechanical digestion begins in the mouth as the food is chewed.
but in the case of chemical digestion, it breaks the food into simpler nutrients that can be used by the cells. Chemical digestion begins in the mouth when food mixes with saliva.
for more refer to this:
Hope this helped
and ur welcm
The cuticle blocks water from evaporating from the leaves.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
