1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Otrada [13]
3 years ago
10

What are methods of seeking legal assistance or guidance in a foreign country?

Law
1 answer:
sineoko [7]3 years ago
6 0

Foreign Legal Assistance Statute are methods of seeking legal assistance or guidance in a foreign country

<u>Explanation: </u>

Foreign Legal Assistance Statute provides with various strategies by which a person can seek legal guidance in a foreign country. This statute provides that ‘interested parties’ can ask the U.S. federal court for testimony or the document from any person who is residing in U.S.

If that information or document is relevant in the legal proceeding pending in the foreign country.  This helps the lawyers in the foreign country to obtain information necessary to their case which otherwise they cannot obtain.

You might be interested in
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
A. Imagine the white car in the left lane is moving more slowly than the surrounding traffic. How is this a violation of state u
True [87]

The correct statement is that driving slower in the left lane is a violation of traffic law, as the laws don't permit to drive slower in the left lane. Slower driving can be exercised in the right lane.

The drivers cannot follow the practice of driving slower than the surrounding speed of other cars, as it makes the road dangerous and is punishable with appropriate fines and penalties.

<h3>Traffic Rules. </h3>

  • As the drivers in the right lane are allowed to drive at a speed irregular of the other speeds of left lanes, they are required to change their pace at different times.

Hence, the drivers driving at slower speed in the left lane is considered to violate the traffic laws.

Learn more about traffic rules here:

brainly.com/question/7634466

4 0
2 years ago
Read 2 more answers
How do you tell The difference between a crocodile and alligator
pentagon [3]

Explanation:

Alligators have wider, U-shaped snouts, while crocodile front ends are more pointed and V-shaped.

8 0
3 years ago
Negotiation is the process by which people involved in a dispute discuss their problem and try to reach a solution acceptable to
xeze [42]
The answer is true.

Negotiation is a process where people who have a dispute try to reach a compromise that everyone is good with.
4 0
2 years ago
John Broderick classified police officers by their degree of commitment to maintaining order and their respect for due process.
madreJ [45]

John Broderick is classified as Vigilante officer.

Option D

<u> Explanation: </u>

A committed officer whose main priority is to protect people from any untoward incidents is construed to be a vigilante officer. Vigilante is nothing but always watching the people who are trouble mongers and keeping an eye on their movement to protect others from get harmed by this trouble mongers.

John Broderick is also a committed vigilante officer who will watch around the neighbourhood and ensure that the place free from any crime and protect the people from any eventualities.

4 0
2 years ago
Other questions:
  • 8. A special danger of drug use is that you __________. A. can never know when it's unsafe to drive B. must commit a crime in or
    14·2 answers
  • What is the difference between crime and ethics?
    10·1 answer
  • An untruth about a person that will likely do them harm is known as: A. Periodical B. Libel C. Obituary D. Publication
    12·1 answer
  • When Congress passed the Underwood Tariff Bill in 1913, it intended the legislation to a eliminate tariffs as a source of revenu
    12·2 answers
  • Write 75 as a product of prime factors.
    10·2 answers
  • How can I improve my credit score without going into debt
    15·1 answer
  • How could U.S. national interests lead to potential conflicts with other countries?
    6·2 answers
  • What do u guys think of this its my rap
    14·1 answer
  • The Great Compromise called for representation in the House of Representatives to be based on
    5·1 answer
  • Which of the following is NOT protocol if a parent feels an education record is inaccurate or misleading?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!