1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
3 years ago
7

Which of the statements below is NOT TRUE about meiosis and/or mitosis.

Biology
1 answer:
Rashid [163]3 years ago
5 0
A)
This is because the lining up of homologous pairs does not affect the process; the processes deviate from one another when chromosomes are pulled to different ends.

You might be interested in
98. Which of the following substances requires a transmembrane protein in order to cross a cell membrane?
STatiana [176]

Answer:

la le rechaza ace chuchu la lechuza la ase zhu ala aa anldbduevvla lechuaza

3 0
2 years ago
All living things are made up of building blocks known as ______.
Dafna1 [17]

Answer:

cells.

Explanation

6 0
3 years ago
Read 2 more answers
What is the Milky Way?
swat32

Answer:

our universe

Explanation:

6 0
3 years ago
Read 2 more answers
Does the protein solution have a high molarity? what is evidence for your conclusion?
xxMikexx [17]
NO, the protein solution do not have a high morality. The protein solutions generally have lower molarities. This is because protein molecules are larger in size and do not form a soluble and uniform solution. Protein molecules do not dissolve in solutions.
8 0
2 years ago
What kind of atom tends to lose one electron?
NISA [10]

Answer:

An atom with a single electron in its outermostshell

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • DNA is characterized by a single helix and ribose sugars
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • __________ will increase soil nitrates, while ___________ will decrease soil nitrates.
    11·1 answer
  • What happens when corn works as fuel for an animal
    11·1 answer
  • Sustancia que regula la temperatura del cuerpo, ayuda a llevar nutrientes y oxígeno a las células, convierte los alimentos en en
    13·1 answer
  • Consider plant roots and stems. Which tropism affects both these plant tissues? Which tissue experiences negative tropism versus
    13·1 answer
  • when you mix instant coffee creamer sugar and hot water all together what kind of mixture are you going to form​
    13·1 answer
  • Which of the following best explains how the characteristics of index fossils are useful to geologists?
    8·1 answer
  • Can some one help me :(.
    13·1 answer
  • Which pair of structures would provide a positive identification of an animal cell under a microscope?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!