1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astraxan [27]
3 years ago
6

Which is the best description of civil liberties?

Biology
2 answers:
Vesna [10]3 years ago
5 0
Civil liberties are specified in a legal text like constitution and it's amendments or in treaties such as European convention on human rights
LekaFEV [45]3 years ago
4 0
They guard the rights and freedom of citizens of the United States.
You might be interested in
A group of organisms of the same species that live together in the same place at the same time are called a/an
Usimov [2.4K]
It is called  a population since they are all the same species 
3 0
3 years ago
Read 2 more answers
In humans, the eye color and hair color genes are located on different chromosomes. Brown eyes (B) are dominant to blue (b), and
Andrej [43]

Answer:

Man's genotype: Bbdd

Woman's genotype: bbDd

First child's genotype: Bbdd

Second child's genotype: bbDd

Explanation:

This is a dihybrid cross involving two genes; one coding for eye color and the other for hair color in humans. The allele for brown eye (B) is dominant over the allele for blue eyes (b) in the first gene while the allele for dark hair (D) is dominant over the allele for red hair (d) in the second gene.

According to the question, A man with brown eyes and red hair will possibly possess genotypes: BBdd or Bbdd while a woman with blue eyes and dark hair will possibly have genotype: bbDD or bbDd. Considering the fact that they produced children with recessive traits for both gene (blue eyes and red hair), it means that they are heterozygous for their dominant trait. This means that the ideal genotype for the man is Bbdd since he will produce gametes containing B and b alleles for the first gene while the ideal genotype for the woman is bbDd since it will produce gametes with D and d allele for the second gene.

Hence, a child with brown eyes and red hair will possess genotype: Bbdd since he/she cannot receive two dominant alleles for the first gene from both parents. A child with blue eyes and dark hair will have genotype: bbDd since he/she cannot receive two dominant alleles of the second gene from both parents.

3 0
3 years ago
What does a mass extinction look like in the fossil record?​
gtnhenbr [62]
There is less diversity hope this helps
8 0
3 years ago
Read 2 more answers
Signals are transmitted between the extracellular matrix to the cytoskeleton through __________ proteins.
evablogger [386]

Answer: Integrins

Explanation: Integrins are proteins and are the principal receptors that attach the cell cytoskeleton to the extracellular matrix (ECM). Integrins by sense whether adhesion has taken place that is to say a cell can regulate the adhesive activity of its integrins from within.

7 0
3 years ago
Both parents can roll their tongue, yet their child cannot. What must the parent's
jeka94
The answer is C Heterozygous

Explanation: the inability to roll your tongue is a recessive trait. Since both parents are heterozygous, they carry that recessive gene, so their child will have a 25% chance of having that recessive trait; and therefore, unable to roll their tongue.
3 0
3 years ago
Other questions:
  • Why can the same earthquake have different ratings on the Richter Scale and the Moment Magnitude Scale?
    5·1 answer
  • Biologists in louisiana have become concerned about cadmium levels in the water near new orleans and the probability that frogs
    13·2 answers
  • Richard is an avid gardener who spends a lot of time caring for the plants in his garden. To minimize damage from pests from his
    9·1 answer
  • 4. Sports physiologists at an Olympic training center want to monitor athletes to determine at what point their muscles are func
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What happens to metabolism if calorie intake remains below BMR for a significant period of time?
    11·1 answer
  • The hierarchy of traits is a structured progression of personality that begins with a few higher-order traits that result in sev
    5·2 answers
  • What is one specific example of negative feedback in the human urinary system?
    15·1 answer
  • According to Kepler's second law of motion, which statement describes the area
    12·1 answer
  • An itemt hat is free of all viable microbes including endospores is considered to be?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!