1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovangra [49]
3 years ago
15

Please help me!!!!!!!!!!!

Biology
1 answer:
solmaris [256]3 years ago
4 0
I believe that the answer is B.
You might be interested in
In gel electrophoresis, what is the agarose used for?<br> I NEED HELP I HAVE 4 mins left on my exam
vitfil [10]

Answer: answer

Explanation: Agarose gel electrophoresis separates DNA fragments according to their size. Typically, a DNA molecule is digested with restriction enzymes, and the agarose gel electrophoresis is used as a diagnostic tool to visualize the fragments. Electricity is used to move DNA molecule fragments through the agarose gel.

6 0
3 years ago
Read 2 more answers
Identify the polysaccharide formed from the enzyme insulin as a means to remove glucose from the blood.
choli [55]

Answer:

(C) glycogen

Explanation:

The polysaccharide formed from the enzyme insulin as a means to remove glucose from the blood is glycogen.

When glucose level in blood rises insulin is released from Pancreas that promotes the uptake of glucose into liver cells converting glucose into long chain polysaccharide that are stored in the liver. Glucose makes 6-10% of the liver.

4 0
3 years ago
Greg decides to enhance his reptile-breeding income by branching out into bearded dragons. He crosses two dragons that are heter
-BARSIC- [3]

Answer:

Pleiotropy

Explanation:

The genetic pattern demonstrated here is pleiotropy. Pleiotropy occurs when a gene or allele controls more than a single trait, the gene for red-stripe also controls the size of the reptiles.

7 0
3 years ago
Risk of using bio pharmaceuticals
Ray Of Light [21]

Answer:

The potential risks associated with plant-based pharmaceuticals include: pollen transfer to related species, contamination of non-transgenic crops intended for the consumption by humans, allergic reactions to the drugs produced from the genetically engineered plant, and persistence of genetically engineered material to persist in the environment and accumulate in non-target organisms. Risk assessment of plant-made pharmaceuticals should be reviewed on a case-by-case basis because the plants used to produce proteins each have different risks associated with them.

3 0
3 years ago
What problems does plastic help us solve that we can't use other materials for?
Juliette [100K]

Answer:

El cuidado del medio hambiente

Explanation:

Es porque si usamos un traste ya sea un embase estamos cuidando el medio hambiente,y si usamos bolsas u otras cosas que son inorganicos

contaminan nuestro hambiente.

4 0
3 years ago
Other questions:
  • A plant nursery only grew one type of tomato plant. All of their tomato plants died from the same disease. What was most likely
    14·1 answer
  • The fingerlike projections on the surface of the cell are called cilia and are used in which of the following processes?
    7·1 answer
  • Which statement best illustrates a biotic or an abiotic factor that is often found in a city park?
    5·2 answers
  • Which of the following describes why wetlands are so important to the water cycle?
    9·1 answer
  • How many copies of genetic material is in an interphase chromosome?
    8·1 answer
  • THE RIGHT ANSWER WILL RECIEVE A BRAINLEST AND POINTS AND THANXS!!!
    13·2 answers
  • What is true about warm, saturated air
    7·1 answer
  • Match the following terms and definitions
    8·1 answer
  • Which type of fossils is MOST helpfu
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!