1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
4 years ago
9

What happened to the water in the 1st stages of photosynthesis?

Biology
2 answers:
Tresset [83]4 years ago
8 0

The water realeases and forms into oxygen gas and hydrogen ions

nexus9112 [7]4 years ago
5 0

Answer:

The energy of the sunlight is absorbed by the chloroplast. The water reacts in sunlight to form one glucose molecule and the water releases oxygen as that is part of it's role.

Explanation:

You might be interested in
• How did the National Research Act change the way research was conducted?
leonid [27]

Answer:

The National Research Act of 1974 set the stage for several important systems of checks and balances in clinical research. It led to the creation of the National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research, as well as the Belmont Report and Institutional Review Boards (IRBs).

Hope This Helps!

7 0
3 years ago
Why will a semi-permeable membrane diffuse selected molecules
Lilit [14]
Because that literally means what a semi-permeable membrane is.It allows some things to pass through it, and others not to
8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
An earthworm contains both male and female parts in its body.<br><br> True<br> False
lara31 [8.8K]

Answer:

True

Explanation:

Earthworms are hermaphrodites.

Hermaphrodites ⇒ a person or animal having both male and female organs or other characteristics

[RevyBreeze]

6 0
2 years ago
Read 2 more answers
Which of these types of governmental structure essentially controls every aspect of citizens' lives?
dimulka [17.4K]

Answer;

-Totalitarianism

Explanation;

-Totalitarianism refers to a political system in which all authority is in the hands of the state. In a totalitarian society, all control of public and private life are government run.

-A totalitarian society is usually ruled by a dictator, and there is very little or no freedom. In totalitarianism, the government controls almost every aspect of life. For example, Hitler employed totalitarianism as a means to attempt to achieve an obedient nation that was his personal vision for the country.

8 0
3 years ago
Other questions:
  • What would be classified as amorphous
    7·1 answer
  • Mucus membranes trap pathogens that are airborne. <br> a. True<br> b. False
    11·2 answers
  • A nurse is delivering 3 l/min oxygen to a patient via nasal cannula. what percentage of delivered oxygen is the patient receivin
    10·1 answer
  • Evaporation of sweat cools the skin because A. Liquids reduce the average kinetic energy of a surface by slowing down molecular
    15·1 answer
  • How do humans use plant's ability to reproduce asexually
    12·1 answer
  • 14. The attraction among molecules of different substances is called
    12·1 answer
  • Help me thanks!!!!!!!!
    6·1 answer
  • Which of these events would lead to an increase in the size of a population of squirrels
    6·1 answer
  • Which human body system performs a function similar to what the mitochondria perform for the cell?
    5·1 answer
  • NO LINKS HELP NEEDED ASAP
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!