1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
3 years ago
6

On a strand of the mRNA the bases are read in groups of three. What is the correct term for a group of three bases on the strand

of mRNA?
Biology
2 answers:
mart [117]3 years ago
5 0
It is a codon. A codon codes for Amino acids and an Anti-codon Codes for the breakdown of Amino Acids.
densk [106]3 years ago
3 0

Answer:

The correct answer would be codon.

Codon refers to the sequence of three consecutive nucleotides (DNA or RNA) which codes for a specific amino acid.

For example, AUG codes for methionine, CCA codes for proline, GUU codes for valine, UGA is a stop codon et cetera.

The nucleotide sequence of the DNA is transcribed into the codon sequence of the mRNA.

The codon sequence of the mRNA codes for the amino acid sequence of the polypeptide chain.

The codon is deciphered with the help of the anti-codon site of the tRNA.

You might be interested in
All living organisms are classified into one of three domains: Bacteria, Archaea, and Eukarya. Organisms in the domianns Bacteri
statuscvo [17]
They are prokaryotes
6 0
4 years ago
Read 2 more answers
PLEASE HELP ME <br> IDENTIFY AND EXPLAIN AN EXAMPLE OF LONG-TERM CLIMATIC CHANGE
frez [133]

Answer:

hope this helps!

Explanation:

Climate change  includes all the differences in the climate that last longer than individual weather events, such as  the term climate change only refers to those variations that last  for a longer period of time, typically decades or more. In addition to the general meaning in which "climate change" may refer to any time in Earth's history, the term is commonly used to describe the current climate change now underway. In the time since the Industrial Revolution, the climate has increasingly been affected by human activities that are causing global warming and climate change. It is also effected by human disturbance to the earth.

pls put me brainliest!

7 0
3 years ago
Read 2 more answers
What is the function of the enzyme RNA polymerase during transcription?
allsm [11]

Answer:

RNA polymerase is an enzyme that is responsible for copying a DNA sequence into an RNA sequence, duyring the process of transcription.

8 0
3 years ago
What makes a thing non living?
zhenek [66]

Answer:

which does not breath

Explanation:

7 0
3 years ago
Example of sex linked traits
hjlf

male tesosterone can affect facial hair, voice deepness, testicle size, muscle mass, agressiveness, etc

8 0
3 years ago
Other questions:
  • What is the name of the condition in which tissue from the lining of the uterus grows outside the uterus?
    8·2 answers
  • If the ribosomes in a cell were rendered useless, the cell would most likely be unable to
    9·1 answer
  • What is the purpose of B cell and T cells during specific immune response
    13·1 answer
  • if you are suffering from a cardiovascular malady the doctor might order an_____ After that you might need ______.
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which of these processes as a cooling affect on earth? (APEX)
    8·1 answer
  • A client is diagnosed with both hypothyroidism and adrenal insufficiency. If the adrenal insufficiency is not treated first, wha
    13·1 answer
  • A characteristic that causes ocean jellies to be classified into the phylum Cnidaria is the presence of
    15·2 answers
  • Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
    12·1 answer
  • Https://onmuga.com/drawitout/8XO4EJ
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!