1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firdavs [7]
4 years ago
5

Help please? Need help please.

Biology
1 answer:
mojhsa [17]4 years ago
3 0

asdfghjkl;'

asdfghjkl;'

asdfghjkl;'

asdfghjkl;'

asdfghjkl;'

asdfghjkl;'

asdfghjkl;'


You might be interested in
How are the organ system in a human interrelated
Nitella [24]

Answer:

Different organs in the body work together to make organs systems. The different organ systems are interrelated to ensure the normal functioning of the body. The survival of an organism depends on the co-related activities of the organ system.

For example, the respiratory system and the circulatory system work together to provide oxygen to all the body cells and to eliminate carbon dioxide from the body. The circulatory system transports oxygen from the lungs to other parts of the body and transports carbon dioxide from the body parts to the lungs.

The nutrients required by the blood and other organs of organ systems are provided by the blood of the circulatory system.

The blood of the circulatory system is filtered by the kidneys of the urinary system.

3 0
3 years ago
Answer Under 20-30 minutes and I give a brainiest!!
Lilit [14]

Answer:

try the answer a if I'm wrong sorry

4 0
2 years ago
Read 2 more answers
This is Ampifly Science 6th grade
zimovet [89]

Answer:

1, Amount of energy from the sun

2, Personal question

3, Based on the climate, the sun can produce more energy in certain areas over others. The most solar energy will be produced in warmer areas because there is more sun.

Explanation:

3 0
2 years ago
In your own words, how does a virus work?
Rina8888 [55]

Explanation:

viruses are very small -- 100 times smaller than the average bacterium, so small that they can't be seen with an ordinary microscope. Viruses can only exert influence by invading a cell, because they're not cellular structures. They lack the ability to replicate on their own, so viruses are merely tiny packets of DNA or RNA genes enfolded in a protein coating, on the hunt for a cell they can dominate.

7 0
4 years ago
When substances ABSORB energy, the particles move ____. <br><br><br> PLEASE ANSWER! WORTH 12 POINTS!
SCORPION-xisa [38]

Answer:

explanation

Explanation:

it it depends whether or not thermal energy or heat is being transferred to the particles if thermal energy is being transferred to the particles the particles will move faster.

5 0
3 years ago
Other questions:
  • Why do we control the variables we are not investigating
    13·2 answers
  • A unicellular microorganism was recovered from a hot spring (95oC) in Wyoming. The cells lack a nucleus, have a cell wall that l
    6·2 answers
  • When it comes to something like food preferences, how do genetics and the
    9·1 answer
  • How do spores help sustain the population of ferns?
    10·2 answers
  • Explain how the independent alignment of homologs, and also crossing-over during the first meiotic division, each contribute to
    11·1 answer
  • Aquatic biomes are classified as either __________ or __________.
    13·1 answer
  • transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
    7·1 answer
  • A sonar pulse has a wavelength of 3.2 cm and a speed of 1,500 m/s in water. What is the frequency of the pulse? (
    9·1 answer
  • Who was the first person to start classifying organisms
    13·2 answers
  • Explain why air exhaled during exercise contains more carbon dioxide than exhaled at rest​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!