1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
3 years ago
12

Which structure does not belong to the pulmonary circuit?

Biology
1 answer:
12345 [234]3 years ago
4 0

Answer:

which structure does not belong to the pulmonary circuit?

A) left ventricle

B) right atrium

C) right ventricle

D) pulmonary trunk.

please help and define the difference in pulmonary circuit and pulmonary circulation. thanks

You might be interested in
Which of these hormones increases ca++ concentration and slightly decreases phosphate ion concentration in the blood?
S_A_V [24]
Parathyroid   hormones (PTH)   increases the        Ca++  concentration  and slightly   decreases   phosphate  ion concentration  in the blood.
   When   Parathyroid  hormone increases, the body  release  more  calcium   from  bones into  blood    which  lead to the increase  in calcium concentration in  the blood. 
    The  parathyroid  hormone increase  in the other hand  led to slightl
y  decrease  in phosphate  ions since   it reduces  the reabsorption  of phosphate    from  proximal  tubule   of the kidney
4 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Where would you find the scales of birds?
Serga [27]
You would find scales on a bird is it feet
8 0
3 years ago
"under what internal conditions does air tend to flow into the lungs"
SIZIF [17.4K]
Increase in thoracic volume, decrease in pressure

4 0
2 years ago
A _______ publishes short sentences that only take a few seconds to write, rather than long stories or posts.
USPshnik [31]

Answer:

Microblog

Explanation:

Microblog can be describes as a mixture of both blogging as well as instant messaging. Microblogging allows the users to share short messages as well as it also allows posting of these messages with an online audience. The content of micro blogging is much smaller as compared to the traditional blogging . The actual as well as the aggregated sizes of files of microblogging are much shorter than the tradiotional bloggings.

6 0
3 years ago
Other questions:
  • Which feature of the sun extends into the corona but is anchored in the photosphere?
    12·1 answer
  • Why are Bats blind?<br><br> *heeylo*
    9·2 answers
  • What macromolecules are capable of self-replication?
    14·2 answers
  • What do two different neutral isotopes of the same element have in common?
    15·2 answers
  • A stomach is made up of multiple tissues. What level of organization is a stomach?
    13·2 answers
  • Amylase increases the rate at which starch is broken down into glucose. What kind of molecule is amylase?
    8·2 answers
  • Which of the following is used to describe DNA's double helix shape?
    6·2 answers
  • Guys I need help with the first one pls I will appreciate it
    12·2 answers
  • Use the data and what you have learned about evolution to explain how mutation is a random process, but natural selection is not
    9·1 answer
  • A ______ color scheme consists of shades, tints, or tones of the same color. group of answer choices analogous complementary tri
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!