Answer:
Your answer would be betwen 400 to 700 nm
Answer:
Thick diameter, Myelinated
Explanation:
A alpha neurons conduct action potentials faster because of their large axon diameter and myelin.
- The large diameter is less resistant to the flow of ions and allows for faster conductivity.
- The myelin sheath is a layer of fat acting as to insulate the axon which helps increase signal conductance.
Answer:
The correct answer is - They don't want to be exposed and seen for what they do.
Explanation:
Vince Edwards was the chicken grower in a poultry farm for Tyson. They used to treat harsh conditions that are considered as animal cruelty for making them large in size with large breasts and with more muscles.
Vince and Tyson did not give permission to allow the filmmakers inside the chicken coops because they were afraid to get exposed that how bad the condition of chickens and grow them unethically for just their benefits to earn more.
Type 1 stools are detached, hard lumps that be similar to nuts that are tough to pass. Type 3 stools are like a sausage, but with pops on the surface. Type 5 stools are mushy blobs with clear-cut ends that are passed effortlessly. Type 6 stools are cottony pieces with raggedy edges.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand