1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firdavs [7]
3 years ago
9

Like logistic growth, exponential growth

Biology
1 answer:
zhenek [66]3 years ago
5 0

A. is slowed by limiting factors. B. exhibits a period of rapid growth as the population size increases. ... Like logistic growth, exponential growth can be plotted in the shape of an S curve.

You might be interested in
What is mass.........................................?​
den301095 [7]
Anything that takes up space
7 0
3 years ago
Read 2 more answers
Some students believe that if they drink a glass of milk before bed and would make them sleep longer what’s the independent vari
miss Akunina [59]

Answer:

Independent variable: Glass of milk

Dependent variable: Time of sleep

Control variable: same type of milk

Explanation:

Independent variable in an experiment refers to the variable that the experimenter manipulates or changes in order to get a response in another variable (dependent). In this case, the independent variable is the GLASS OF MILK taken before bed.

Dependent variable is that variable that is measured in an experiment. It is the variable that responds to the changes made to the independent variable. In this experiment, the dependent variable is the TIME OF SLEEP of the students.

A control variable or constant is the variable that is kept unchanged throughout the course of the experiment in order not to alter the outcome of the experiment. In this experiment, a control variable can be the SAME TYPE OF MILK taken by each student.

6 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Is this a picture of DNA or RNA?
kiruha [24]

Answer:

RNA

Explanation:

8 0
3 years ago
Read 2 more answers
Which of the following tasks is an example of how scientists might use writing skills in their jobs?
Molodets [167]
I didn’t see any of the following but I can say that one reason they use it is to record their findings
5 0
3 years ago
Other questions:
  • Which molecule listed in the chart is a protein
    6·2 answers
  • 1.The Punnett square above shows a cross between two sweet pea plants in Mendel's
    6·2 answers
  • IF YOU ARE RIGHT YOU GET BRAINLIEST
    12·2 answers
  • If you weigh 150 pounds on Earth,
    5·2 answers
  • A cation that is more abundant as a solute in the cytosol of a neuron than it is in the interstitial fluid outside the neuron is
    7·1 answer
  • Using complete sentences, explain how proximity to major rivers influenced the location of early cities.
    10·2 answers
  • Which of the following is composed of more than two hundred billion stars, including the sun? (1 point)
    8·1 answer
  • 1 Invasive plant species affect the interactions of living and nonliving components
    14·2 answers
  • The car company is trying to make a car that is more fuel efficient, meaning it takes less force to get the car to move. Explain
    12·1 answer
  • What are the filaments called that help some bacteria stick to surfaces and exchange plasmids through conjugation?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!