1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yaroslaw [1]
3 years ago
7

20. What condition is required for ATP synthase to move hydrogen down its gradient? A. More ATP molecules ahead of the hydrogen

than below it B. More hydrogen ions outside the membrane than inside it C. More hydrogen ions inside the membrane than outside it D. A day with 75 percent direct sunlight
Biology
2 answers:
Aleksandr-060686 [28]3 years ago
4 0

Answer:

B

Explanation:

This H+ ion gradient is referred to as a proton motive force. It is  created using energy from the Krebs cycle in the matrix of the mitochondria. As electrons are passed from one protein complex to another, reducing molecules such as NADH and FADH2, the protons are pumped to the intermembrane space of the mitochondria. ATP synthase uses this potential to generate ATP as the H+ ions move downgradient (back to the matrix) through channels in the protein enzyme.  

Sedbober [7]3 years ago
4 0

Answer:

C. More hydrogen ions inside the membrane than outside it

Explanation:

I just took the test and C is 100% right

You might be interested in
This is a model to help students understand the process of photosynthesis, which allows plants to create their own food. The GRE
mihalych1998 [28]
<span>it is incomplete and does not show all reactants and products.</span>
3 0
3 years ago
Read 2 more answers
An E OSY T M has both biotic and abotic<br><br><br><br><br> Science
Lorico [155]

Answer:

yes. a ecosystem consist of both biotic and abiotic factor

5 0
3 years ago
What trait most likely evolved in ferns that was not
nata0808 [166]

HI Mate! The right answer is vascular tissue!

5 0
3 years ago
Which of these geological features would most likely occur where tectonic plates move away from each other?
Ahat [919]

Hot spot volcano, hope this helps

8 0
3 years ago
Identify one hormone directly involved in the human female reproductive system that could cause this problem
UkoKoshka [18]
The HCG hormone is the answer possibly
4 0
3 years ago
Other questions:
  • if the parent cell has 32 chromosomes and goes through meiosis, the daughter cell will have how many number of chromosomes
    11·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Sheela wants to make a computer model of a land ecosystem. Part of her model simulates the chemical processes of photosynthesis
    11·2 answers
  • How is sound detected by the barin
    13·1 answer
  • What does it mean when we say th at the two strands of DNA in the double helix are anti parallel
    13·1 answer
  • Scientists were. about whether dolphins could be used as therapy animals
    6·1 answer
  • What is cell membrane
    14·2 answers
  • Organisms with traits best suited to their environment, survive during what process?
    12·1 answer
  • Sexual reproduction helps to increase _<br> The advantage of asexual reproduction is _
    15·1 answer
  • What is anatacid . explain nd give examples of it .​<br>❤❤❤
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!