Answer:
The total length will be "10 units". A further explanation is given below.
Explanation:
The given points are:
R(−2, 4)
S(3, 4)
T(3, −1)
On applying the distance formula,
⇒ 
⇒ 
⇒ 
⇒ 
⇒ 
and,
⇒ 
⇒ 
⇒ 
⇒
Now,
The total trail length will be:
= 
= 
= 
I think it's the nucleus. Isn't the nucleus the brain of the cell?
I hope this help but the metalloids is gruop five if that what your asking if not i will answer the other question for you
Enzymes can be inhibited in different ways this can inclued three types of reversible enzyme inhibition: competitive, non-competitive and uncompetitive.
<h3>How can enzymes be inhibited?</h3>
Irreversible and reversible enzymatic inclusion. A valent-chain inhibitor occurs with a valent-chain inhibitor, whereas a valent enzyme does not occur with a valent-chain inhibitor.
In enzymatic inhibition, the inhibiting substance forms chemical bonds with the enzymes in order to interfere with their catalytic activity. This inclued types of enzyme inhibition:
- Irreversible inhibitors bind to enzymes leading to their definitive inactivation. These inhibitors are very toxic to the body as they are not specific, being able to inactivate any enzyme.
- Reversible inhibitors can be divided into two groups: competitive and non-competitive. This division is based on the presence or absence of competition between the inhibitor and the substrate for the active center of the enzyme.
See more about enzymatic inhibition at brainly.com/question/13174512
#SPJ1
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
