1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry [639]
4 years ago
8

There are three main checkpoints in the cell cycle. Each checkpoint serves a different purpose and have their certain cyclins pr

esent. At the G1 checkpoint, a cell undergoes certain conditions to see if it is prepared for cell division. If a cell receives restrictions from the G1 checkpoint and can not continue into the next phase, what could the cell do next?
A) All cells pass the G1 checkpoint and enter into the next phase.
B) The cell can enter the G0 (resting stage) until conditions can improve.
C) The cell will always go directly into the G2 checkpoint to continue the cell cycle.
D) The cell will directly enter the M phase and all of the errors will be fixed during this phase.
Biology
2 answers:
zavuch27 [327]4 years ago
6 0

Answer:

B

Explanation:

it will go into G0 until conditions improve. If they dont it will go through apoptosis

Margaret [11]4 years ago
3 0
Not 100% sure but i’m like 99.9% sure it’s B
You might be interested in
Which region of the insect's body is specialized for sensory functions?
RSB [31]
 sensory functions are found on the head of an insect , they have a single pair of antenna , mouthparts adapted for chewing or sucking.
7 0
3 years ago
Read 2 more answers
Chemical bonding please help!
olga_2 [115]

Answer:

A chemical bond is a lasting attraction between atoms, ions or molecules that enables the formation of chemical compounds. The bond may result from the electrostatic force of attraction between oppositely charged ions as in ionic bonds or through the sharing of electrons as in covalent bonds.

8 0
3 years ago
Why urination and ejaculation cannot go together?
MAXImum [283]
They are two very different tunings. Urination is basically releasing your urine while the other one relates to releasing sperm..
6 0
3 years ago
Read 2 more answers
Which of these organisms are herbivores?
r-ruslan [8.4K]

primary \: consumer

7 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • What peptide would you expect to result from a 21-nucleotide-long DNA sequence that contains only the base adenine?
    10·1 answer
  • What would happen without enzymes
    8·1 answer
  • In _____ of meiosis, homologous chromosomes pair
    11·2 answers
  • Compare and contrast the way in which moons and ring systems form
    8·1 answer
  • What is the probability of producing offspring that is white in color? If I said 50% how would it be wrong.
    8·2 answers
  • What is the purpose of oxygen in cellular respiration?
    8·1 answer
  • Como trabaja el corazón con los pulmones para circular?
    13·1 answer
  • Do temperate phage form plaques? Explain?
    12·1 answer
  • What one of the following items is a producer of pollution?
    10·2 answers
  • below is a base sequence for the normal protein for normal hemogoblin and the base sequence for the sickle cell hemogoblin. Tran
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!