During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Facilitated diffusion
<span>The word 'diffusion' means free movement across distance, with or without the presence of a barrier. However, there is a phenomenon known as facilitated diffusion which occurs at the cellular level. The cell does not allow free radicals and other harmful substances to enter and harm the cell organs. This is possible due to the structure of the cell membrane. The structure is such that, it allows only certain things to pass in and out of the cell. One such activity that allows selective movement in and out of the cell is the process of facilitated diffusion.</span>
They both act like filters. The coffee filter makes sure that coffee doesn't go in the drink and the kidney makes sure solids don't pass by.
Answer:
Chloroplasts are found in plant cells, they make up the green pigment ( chlorophyll ) which manufactures food for the plant during photosynthesis process.
