1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlada [557]
3 years ago
7

Which of the following are characteristics of heterogeneous mixtures?

Biology
1 answer:
V125BC [204]3 years ago
7 0
The correct answer is Distinguishable components, components in varying proportions, particles that may settle. All other belong to homogenous mixtures.
You might be interested in
Which of these requires a host cell to copy its genetic material and protein coat?
svet-max [94.6K]

The virus' DNA becomes a part of the host cell's DNA, and every time the host cell copies and divides, it also copies viral DNA. The viral DNA may remain inactive (a provirus) for a long time, but it can become active when it frees itself from the host's chromosome, which triggers the lytic cycle.

I forget which one is the virus' DNA


3 0
4 years ago
Read 2 more answers
A control group is a group that:
Akimi4 [234]

Answer:

It is a group designed to not be affected by any variables and to be used as a comparison to the other groups. It helps increase the reliability of your results, as it shows your independent variable is what made something happen in your experiment.

8 0
3 years ago
Define the term osmosis and give an example.​
makkiz [27]

Answer: Osmosis is the movement of water or other solvent through a plasma membrane from a region of low solute concentration to a region of high solute concentration, tending to equalise the concentrations of the solutes. Osmosis is passive transport, meaning it does not require energy to be applied.

Examples of osmosis in daily life include plant cells soaking up water, skin soaking up water, and slugs reacting to salt.

7 0
3 years ago
The adaptation that allows some of these animals to run fast would be an example of natural selection if it helps them
ad-work [718]

Answer:

a chaeta runs fast to catch its pray Please Mark Me Brainliest

Explanation:

8 0
3 years ago
The effect of cholesterol on membrane fluidity at physiological temperatures is to Choose one: A. prevent lateral movement of ph
kobusy [5.1K]

Answer:

The correct answer is  D. maintain membrane fluidity through its disruption of fatty acid packing.

Explanation:

<u>Cholesterol</u> is a steroid lipid and is a constituent of biological membranes. It regulates the <em>fluidity</em> of the membrane (so, option C is not correct). Since cell membranes are composed of another type of lipids, the phospholipids, which form a bilayer, cholesterol distributes between the phospholipid tails and avoids these molecules pack each other forming rigid clusters. Thus, the option which better explains the effect is <em>D. maintain membrane fluidity through its disruption of fatty acid packing.</em>

6 0
3 years ago
Other questions:
  • Match each term with its definition. A. Carrying capacity Growth increases, accelerates, then slows B. Exponential growth Result
    11·2 answers
  • Which organisms can be treated with penicillin g (benzylpenicillin)? (select all that apply.)?
    14·1 answer
  • DNA replication results in two-double stranded DNA molecules having nucleotides base sequences that re identical to each other a
    8·1 answer
  • TAKE A LOOK<br> 1. Identify What are two<br> things that are the same in<br> all nucleotides?
    14·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The process of cellular respiration uses glucose and oxygen to make the energy molecule of the cell. What is the name of that en
    13·1 answer
  • !Plz help! !I keep getting different answers! Cellular respiration refers to:
    8·1 answer
  • Give two processes which occur during interphase and which are necessary for
    15·1 answer
  • Which of the following tools helps in the visualization of DNA inside a cell?
    15·1 answer
  • Why is the scientific name for a gorilla, Gorilla gorilla?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!