1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leviafan [203]
3 years ago
12

Human activities can alter earth’s natural cycles. true false

Biology
2 answers:
olga_2 [115]3 years ago
7 0
It's going to be true 
makvit [3.9K]3 years ago
4 0

Answer: True

Explanation: Manmade activities have altered a lot of natural cyles which includes: introduction of invasive species, climate change, pollution, habitat destruction, fossil fuel digging, land-cover change, overexploitation and many more.

Digging up and burning fossil fuels increases greenhouse effect and it results yo global warming.

You might be interested in
Describe the two types of vascular tissue
creativ13 [48]
The answer would be the xylem and the pholem
3 0
3 years ago
Read 2 more answers
Which kingdom contains organisms that are multicellular,heterotrophic, eukaryotic and lack cell walls
Anastaziya [24]
<span>Animalia -</span><span>  Mammals, amphibians, reptiles, birds, fish, mollusks, and insects are all included in this kingdom.</span>
4 0
3 years ago
Read 2 more answers
List any two differences between distance and displacement..​
maw [93]
Distance is the length of the path travelled
displacement is the shortest length of the path travelled

distance does not have direction, hence, it is a scalar quantity
displacement has direction, hence, it is a vector quantity
4 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
The genetic material of a virus consists of..?
NNADVOKAT [17]

Answer:

D) RNA or DNA

Explanation:

Most viruses either have RNA or DNA as their genetic material.

Have a good day everyone :)

4 0
3 years ago
Read 2 more answers
Other questions:
  • Why does the cell need both mRNA and tRNA in order to synthesize a protein like hemoglobin?
    9·1 answer
  • Granite is an igneous rock that forms when magma inside the earth solidifies.
    9·1 answer
  • Blank ?, amount of sugar, and amount of water are some conditions that need to be right in the
    13·2 answers
  • A total solar eclispe cannot be experience from every part of the earth at the same time.Give reason.
    7·1 answer
  • How many types of nucleotides are in dna, and how do they differ?
    12·1 answer
  • Which correctly describes the role of histones in eukaryotic cell division?
    5·1 answer
  • an electric car uses a battery to make the car move. what kind of energy transition is happening in the car?
    10·1 answer
  • PLZZ HELPP THIS IS OVERDUE!
    14·1 answer
  • What family does a mushroom belong to and what species is a mushroom. Please answer ASAP
    15·1 answer
  • What are the most reactive elements of the periodic table
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!