1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nlexa [21]
3 years ago
13

Which series lists the stages of development in the gestational process in order, from beginning to end?

Biology
2 answers:
Fynjy0 [20]3 years ago
8 0

The Answer is B. gametes ® zygote ® embryo ® fetus ® organism

Sveta_85 [38]3 years ago
4 0

Answer:

<u>ITS B.</u> gametes ® zygote ® embryo ® fetus ® organism

Explanation:

You might be interested in
One advantage a plant gets from having flowers is that
defon
C. Flowers are bigger than spores, and there is sexual reproduction in plants with flowers.
7 0
2 years ago
What are the importance in applying fertilizer to a tree?​
MatroZZZ [7]

Answer:

It helps in growth of fruits or root faster .

Explanation:

If fertilizers is applied on trees , insect won't affect and soil will be fertilized for appropriate growth .

3 0
2 years ago
Human blood may contain either or both of two antigens, a and
Molodets [167]
Type O is the remainder after subtracting types A, B and AB.

so percentage of type O blood supply
= 100%-(28+15+10)%
= 100% - 53%
= 47%
6 0
2 years ago
What icon is usually used to indicate an attachment feature?
LuckyWell [14K]

An icon is a symbolic representation of an action to be taken, given in emails or message bars. Icons are metaphorical representations of emotions and feelings which a human is unable to explain in words.

The icon used to represent an attachment is paper clip.

When we click this paper clip icon, it allows us to attach any file including a document or a picture in that particular email. An attachment may also contain a virus, Trojans, worms and other form of malware.

 


6 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • How would you build a model that is ionized? What happens if an atom is too ionized? How would you build a model that is radioac
    14·1 answer
  • You are least productive when you are operating with ________ energy:
    9·1 answer
  • Which parts of the body can exposure to lead
    6·1 answer
  • The skin pigment ____ is responsible for the skin color of dark-skinned people.
    8·2 answers
  • Provide TWO reasons why the genotype and phenotype frequencies do not match in the Tadjik population. (Hint: Think about the met
    8·1 answer
  • Subunits within the cells that perform specific functions are called ______.
    11·2 answers
  • Which checkpoint requires a cell to be of adequate size in order to move to the next phase in the cell cycle?
    11·2 answers
  • What happens to energy content of substance when is heated?
    15·1 answer
  • Which of the following is not a health effect caused by exposure to volcanic gases?
    6·2 answers
  • Of the 10 virus types on the website, which is the smallest?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!