1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhenek [66]
3 years ago
11

A. What is a UTI? Provide a description of the disease as if you were explaining it to a friend who does not know any scientific

terms or concepts. B. Which urinary system structures may be affected by a UTI? Explain how the structure and function of these structures is compromised by the infection.
Biology
1 answer:
olchik [2.2K]3 years ago
7 0

Answer:

A. The urinary tract infections or the UTI refers to the infections found in the urethra, kidney, and bladder. The infection generally takes place because of the entry of bacteria that may invade the urethra or bladder. This leads to irritation in the bladder primarily in women.  

B. In urinary tract infections, primarily the kidneys, bladder, and ureter get affected. The infection is most commonly caused by E.coli and Klebsiella species. In women, the urethra is generally shorter in comparison to males, thus, bacteria can easily invade the bladder most probably at the time of sex.  

The mentioned bacteria are usually found in the digestive tract and may move into the urinary system, mainly at the time of sexual intercourse.  

You might be interested in
Why is Venus the hottest solar system planet?(1 point)
nlexa [21]

Answer:

I think that it is closest to the sun.

Explanation:

it is the second closest planet to the sun.

3 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
How do platelets aid in the healing of cuts?
zepelin [54]
Platelets act like a temporary plug to prevent more blood loss, they act like a blood clot.
8 0
4 years ago
What is the correct order for the levels of organization and living systems from the simplest to the most complex
skad [1K]

Answer:

organelle, cells, tissues, organs, organ systems, organisms, populations, communities, ecosystem, and biosphere

Explanation:

The biological levels of organization of living things arranged from the simplest to most complex

6 0
3 years ago
Johannes wants to know whether soil, water, or both are needed for plant growth. He chooses to conduct experiments on a willow t
Orlov [11]
He needs to use a larger sample size  <span>to improve his experiment.</span>
7 0
4 years ago
Other questions:
  • A tentative explanation to a question about the natural world is a
    9·1 answer
  • The. Are connective tissues dominated by lymphocytes?
    11·1 answer
  • Based on his experiments, Mendel concluded that each trait was controlled by two _____.
    14·2 answers
  • Describe some ways that human activities are affecting aquatic ecosystems. Propose strategies that individuals can use and gover
    11·1 answer
  • What are ionic bonds formed by?​
    11·1 answer
  • What scientist proposed a link between contaminated water and cholera
    7·1 answer
  • Which of the following expressions is not a function of mitosis?
    7·1 answer
  • Which level of the energy pyramid has the least amount of food
    14·2 answers
  • Where did all living things come from? How did Reid’s experiment help to demonstrate this?
    14·1 answer
  • Which of the following answer choices does not include a mechanism for evolution?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!