1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nasty-shy [4]
3 years ago
12

The exchange of carbon dioxide and oxygen in the alveoli of the lungs is an example of what?

Biology
2 answers:
just olya [345]3 years ago
4 0

Answer:The exchange takes place in the millions of alveoli in the lungs and the capillaries that envelop them. As shown below, inhaled oxygen moves from the alveoli to the blood in the capillaries, and carbon dioxide moves from the blood in the capillaries to the air in the alveoli.

Romashka-Z-Leto [24]3 years ago
4 0

Answer:

Gas exchange

Explanation:

<em>Gas exchange can be described as the movement of gases in opposing direction across an interface. In humans and other animals with lungs, gas exchange occur as a process of respiration. </em>

<em>Oxygen is inhaled into the lung. In the alveoli of the lung, the inhaled oxygen  diffuses into the bloodstream within the blood capillaries. Carbon dioxide in the blood travelling within the blood capillaries diffuses the other way (into the alveoli)</em>

You might be interested in
Welches einfache Wort steckt im Begriff "Entsorgung"?
Alborosie

Answer:

Hail Hitler!

Explanation:

6 0
3 years ago
What's Transpiration ?​
mrs_skeptik [129]

Explanation:

Transpiration is the process of water movement through a plant and its evaporation from aerial parts, such as leaves, stems and flowers.it helps in photosynthesis.

6 0
3 years ago
Estuaries are important to humans as a source of A. Plants for food B. Table salt C.drinking water
inna [77]
The correct answer is C) Drinking water. Hope this helps.
3 0
3 years ago
Read 2 more answers
which statement is a hypothesis? A)If the temperature increases, then crickets will chirp more. B)crickets are cooler than grass
Leto [7]

Answer:

C) Does the temperature affect how much crickets chirp

Explanation:

A hypothesis is a question that you test through study and experimentation. Basically a hypothesis is an educated guess that you attempt to prove write(it could be wrong) through an experiment

5 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Other questions:
  • Which of the following statements accurately describes the development of the geologic time scale?
    10·2 answers
  • Of what value are forests besides for wood? Is there a value to forests that is not a monetary value? How much is that value con
    11·1 answer
  • Juan's class is studying soils. Juan and his partner dug a shovel full of dirt and placed it in a jar. They added water and then
    11·2 answers
  • Your teacher gives you this model of transcription. Choose the statement that best describes the role of DNA in transcription.
    10·1 answer
  • If healthy cells come in contact with other cells do they stop growing
    5·1 answer
  • True or false based on the context in paragraph 3 a thin soft pliable sheet or layer
    12·1 answer
  • Anyone know what it is?
    14·1 answer
  • Is red and brown algae more closely related to green algae ?
    6·1 answer
  • Which two factors are used to calculate the kinetic energy of an object ​
    12·2 answers
  • Describe the Endosymbiotic theory
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!