<span>C, Lizards and snakes are more alike since both species have a recent common ancestor. </span>
Its the epidermis because it is subdivided into two layers.
Solids-holds its shape
Liquid-take the shape of whatever its in
Gases- don't take a shape up
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Diabetes (type 2) is the resistance of insulin and is most commonly associated with hypertension and obesity
