1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yuradex [85]
3 years ago
11

Which of the following processes enables cells to stay within the limited range of conditions in which they function best? a bio

diversity b metabolism c adaptation d homeostasis
Biology
1 answer:
SashulF [63]3 years ago
6 0

Answer:

<em>D. Homeostasis</em>

Explanation:

Homeostasis is the internal equilibrium maintained by the cells. If the homeostasis gets disturbed than diseases might occur. The cells maintain its equilibrium throughout the body. With the change in the external environment, the cells also adjusts itself to maintain its stability inside the body.

For example - at higher altitude, the oxygen concentration of the environment is less and to compensate the low oxygen content in the atmosphere, the number of red blood cell inside the body increases.

You might be interested in
Sem 2<br> 1 2.3.5 Quiz: Wasting Away<br> Question 1 of 10<br> is a type of chemical weathering.
Arada [10]
What’s the question?
3 0
2 years ago
The disaster of an oil spill in the Gulf of Mexico occurred on the _______.
Vesna [10]

Answer: It happened from Apr 20, 2010 – Sep 19, 2010

Explanation:

8 0
3 years ago
What is a primary reason an increase in glaciers on land would cause sea level to fall? g?
LiRa [457]
The amount of water on the planet is fixed; it neither increases or decreases. Glaciers are sheets of moving ice. This water to form these extensive sheets must come from somewhere. The water comes from the most extensive store on the planet; the oceans. Ice Ages always corresponds to periods of low sea level because much of the ocean water is is land locked as glaciers. 
4 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Which statements explain the gas exchange that happens at the alveoli? Check all that apply.
V125BC [204]

Answer:

Explanation:

Gas exchange occurs at the alveoli in the lungs and takes place by diffusion. The alveoli are surrounded by capillaries so oxygen and carbon dioxide diffuse between the air in the alveoli and the blood in the capillaries.

3 0
3 years ago
Other questions:
  • Mendel had no understanding of DNA as the genetic material, yet he was able to correctly predict how traits were passed between
    13·1 answer
  • What material (food/air) frog trachea transport? for a frog
    12·1 answer
  • Jim wants to put some ice cubes in his milkshake so he put some water in the freezer. At what temperature Will the transition of
    13·2 answers
  • "children's vaccines are safe" is a proposition of
    10·1 answer
  • Why are carbon dioxide concentrations expected to increase?
    14·2 answers
  • The main use of genetically modified food in the u.s. food supply is to
    15·1 answer
  • Need help with this please...
    13·1 answer
  • BRAINLIESTTT ASAP!!!<br><br> PLEASE ANSWER!!!
    11·2 answers
  • Is dinosaurs dying considered a macroevoluation or a mikroevoluation?
    9·2 answers
  • Genes that code for proteins that promote the cell cycle and inhibit apoptosis are called _____.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!