1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
postnew [5]
3 years ago
6

HELPPP‼️‼️

Biology
1 answer:
lesantik [10]3 years ago
3 0

Answer:

its c, and also i thought ur profile pic was micheal jackson

Explanation:

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
List any 10 common good honey flora.​
vodomira [7]

Answer:

spring vegetation. such as hazel snow drops,primroses,saffron willow,hellsbore,Heather, wild cherry,dandelion,fruit tree,

Explanation:

under the classification

8 0
3 years ago
During photosynthesis, ________ is oxidized, while ________ is reduced.
zubka84 [21]
Glucose is oxidized and co2 is reduced
5 0
3 years ago
Since oil and natural gas are under pressure, they can be _______ up a narrow pipe to the surface.
svlad2 [7]
Blown up a pipe, I think
5 0
3 years ago
Which statement describes surface waves?
mafiozo [28]
It’s in the picture so They travel slower than p waves, they result in much ground motion, they are produced by p and s waves

4 0
3 years ago
Read 2 more answers
Other questions:
  • What compound is released by photosynthesis and used in aerobic respiration
    14·2 answers
  • Two true breeding stocks of fruit flies are crossed. One parent had red, oval eyes and the other had white, round eyes; all F1 i
    10·1 answer
  • What is the word for- all the organisms living in an area and the nonliving features of the environment?
    13·1 answer
  • This map shows the geographic distribution of different tidal cycles along some Earth's coastlines. Areas experiencing
    13·1 answer
  • How many codons are contained in the mRNA that is produced by the “normal” DNA
    7·1 answer
  • Cellular respiration refers to:
    11·2 answers
  • In some forests and parks that contain varieties of flowering trees and shrubs, there are signs that read "Take nothing but pict
    11·1 answer
  • Which of the following is NOT a function of receptors?
    8·1 answer
  • How is the male reproductive system different from other body systems? it is not necessary for an individual's survival. it moni
    5·1 answer
  • What makes using alternative energy sources difficult?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!