Answer:
Outer planets take longer to orbit than inner planets because of the greater distance they need to cover. They also are further from the sun weakening the power of the suns gravitational pull which causes then to orbit slower.
Explanation:
!!
The Light Reactions of Photosynthesis. Light is absorbed and the energy is used to drive electrons from water to generate NADPH and to drive protons across a membrane. These protons return through ATP synthase to make ATP.
<u>What is the end product of light reaction in photosynthesis?</u>
The energy from sunlight is converted into a small amount of ATP and an energy carrier called NADPH. Together with carbon dioxide, these are used to make glucose (sugar) through a process called the Calvin Cycle. This is the things happening during light reaction of photosynthesis .
Hope this helps:)
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
<u><em>Answer: The Calvin cycle is a process that plants and algae use to turn carbon dioxide from the air.</em></u>
<u><em></em></u>
<u><em>hope its helps you.</em></u>
<u><em> keep smiling be happy stay safe</em></u>
Answer:
Electron transport chain and ATP synthase
Explanation:
The inner mitochondrial membrane contains an electron transport chain and ATP synthesis. Four membrane protein complexes serve as the electron carriers and are embedded in the inner mitochondrial membrane. These protein complexes are called complex I, II, III and IV. Transfer of electrons from NADH and FADH2 to terminal electron acceptor oxygen occurs via these protein complexes.
During electron transfer, the pumping of protons towards the inner mitochondrial membrane creates an electrochemical gradient. The downhill transfer of protons back to the matrix via proton channel of ATP synthase drives phosphorylation of ADP. Therefore, presence of all the protein complexes of the electron transport chain and ATP synthase is required for electron transfer and ATP synthesis.
