1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinil7 [7]
3 years ago
6

Which nutrient is a cofactor in antioxidant enzyme systems?

Biology
1 answer:
natta225 [31]3 years ago
3 0

Answer: selenium, copper, iron, zinc, manganese

Explanation:

You might be interested in
What element behaves MOST like magnesium? A) S B) Si C) Sn D) Sr
Zielflug [23.3K]
The right answer is to the question is D.Sr
6 0
3 years ago
Why are some sources of sugar better than others?
goldenfox [79]
Because sugar in fruits is good for you but artificial sugar isn’t healthy for you
6 0
2 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Which of these types of weathering requires the presence of water?
serg [7]

Answer:

A. Abrasion

Explanation:

<em>"In abrasion, one rock bumps against another rock. Gravity causes abrasion as a rock tumbles down a mountainside or cliff. Moving water causes abrasion as particles in the water collide and bump against one another."</em>

<em>-Lumen Learning</em>

8 0
3 years ago
Learning Task 1: WORD UP
HACTEHA [7]

The words for the descriptions are food chain, trophic level, energy pyramid, high diversity, low diversity, etc. respectively.

<h3>Ecology</h3>
  • The feeding relationship that exists among organisms is termed the food chain.

  • Each step in the transfer of energy and matter in a community is termed the trophic level.

  • A community or group of living organisms that live in and interact with each other in a specific environment is termed an ecosystem.

  • A diagram that compares the energy used by producers, primary consumers, and other trophic levels is known as the energy pyramid.

  • An ecosystem with a high number of species is said to be of high diversity.

  • An ecosystem with a few prominent species and a low number of other species is said to be of low diversity.

  • Organisms that feed on and break down organic matter are said to be decomposers.

  • Organisms that can make their own food in the ecosystem are termed, producers.

  • Animals that feed on flesh are called carnivores.

  • A system of interlocking and interdependent food chains is called a food web.

More on ecology can be found here: brainly.com/question/13046612

#SPJ1

7 0
1 year ago
Other questions:
  • One of the most severe consequences of habitat degradation is the _____ of a population.
    13·1 answer
  • For us to feel an earthquake on land it has to register at least _____ or more on the Richter Scale
    5·2 answers
  • What resources can we use for a tornado?
    7·1 answer
  • Most coastal areas have ___ high tides and ___ low tides
    14·1 answer
  • The nurse is providing instruction to family members of a patient who has homonymous hemianopsia. Which statement indicates to t
    9·1 answer
  • Why do scientists need a geological time scale?
    9·1 answer
  • The gestation time for humans has a mean of 266 days and a standard deviation of 25 days. If 200 women are randomly selected, fi
    14·1 answer
  • In fruit flies, a specific gene mutation causes the wings to become malformed. These wings are called vestigial because they do
    8·1 answer
  • 10. Write one example of the way carrying capacity affects communities.
    12·1 answer
  • when the atmosphere changes due to the human activities, how does the change affect humans in return?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!