1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
11

According to this spirographic record, what is the total volume of exchangeable air for a normal male?

Biology
1 answer:
balandron [24]3 years ago
4 0
The appropriate response is 4800 milliliters. The aggregate volume of replaceable air (key limit) for a typical male is the measure of air that can be drawn into the lungs after a constrained exhalation and, for this situation, is 4800 milliliters.
You might be interested in
Describe the genetic makeup of the offsprings of asexual reproduction.
WARRIOR [948]

Answer:

They are genetically identical to the parents and only differ if a genetic mutation occurs.

Sexual reproduction involves two parents and produces offspring that are genetically unique.

The greater the genetic variation, the better change that an individual in the population have a favorable gene that can help survival.  Genetic variation is an important force in evolution as it allows natural selection to increase or decrease frequency of alleles already in the population.

Explanation:

6 0
2 years ago
In a pond environment there are bacteria (Monera), protozoa (Protista), water hyacinths (Plantae),
boyakko [2]

Answer:

minnows which is in kingdom animalia

3 0
2 years ago
Differentiate between the three major climate zone
Bingel [31]

Answer:

tropical, temperate, and polar

7 0
3 years ago
The reproductive cells that have half the number of chromosomes as other cells in the body are called gametes.
Lorico [155]

Answer:

falso

Explanation:

Las únicas células humanas que no contienen pares de cromosomas son las células reproductoras, o gametos, que portan solamente una copia de cada cromosoma

6 0
3 years ago
What is the main idea of Predicting the Next Pandemic (on Readworks)?
evablogger [386]

Answer:

Explanation:

To do proper research and prepare for it

5 0
3 years ago
Other questions:
  • What is a case of selected breeding
    13·1 answer
  • If our visual perception depends only on the feature detectors in the visual cortex, what would we see?
    8·1 answer
  • Muscular strength is assessed by measuring what?
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • This is a homogeneous, generally clear jelly-like material that fills cells.
    15·1 answer
  • If people from Georgia have just experienced an extremely cold winter the last couple of months, what would the
    7·2 answers
  • For several years,researchers have atempted to produce AB artificial blood for transfusions. Artificial blood would most likely
    6·1 answer
  • Short answer: To lower the price of oil and reduce dependence on foreign imports, a federal government is debating whether to op
    11·1 answer
  • HELP PLEASE WILL GIVE BRAINLY!! <br><br> What is a complementary RNA strand to TAG?
    8·1 answer
  • What improves the productivity of cellular respiration?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!