1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
REY [17]
3 years ago
7

L-Arabinose is a naturally occurring, non-caloric sweetener that is a non-competitive inhibitor of sucrase. If L-Arabinose is co

nsumed, what will happen to the Vmax of the reaction and Km of the substrate?
Biology
1 answer:
DedPeter [7]3 years ago
3 0
<h2>Monosaccharine Sugar</h2>

Explanation:

  • L-Arabinose is a low caloric normally occuring 5-carbon Monosaccharine sugar.
  • L-arabinose represses the sucrose action and forestalls expanding blood glucose levels, and in this manner has wellbeing benifits for diabetics and different controlled weight reduction slims down.
  • A normally happening Arabinose is a L-structure, and in light of the fact that it isn't utilized in people it has no caloric worth.
  • <em>L-arabinose has been utilized as a middle of the road fixing in the flavor Industry to create flavors and pharmaceutical industry.</em>
You might be interested in
Starch and ____ are common polysaccharide carbohydrates found in plants.
Novosadov [1.4K]

Answer:

B) cellulose

Explanation:

8 0
3 years ago
What is the leading cause of water pollution in the United States?
monitta
The leading cause is garbage and waste from people.
3 0
2 years ago
Read 2 more answers
In addition to carbon, carbonate minerals contain
shutvik [7]
Carbonate groups contain a single carbon atom, and three oxygen atoms in a trigonal molecular geometry. The carbon atom has two single bonds to two oxygen atoms and a double bond to the third oxygen atom. Therefore, in addition to carbon, carbonate minerals contain oxygen. An example of a carbonate mineral is calcium carbonate, often found within rocks. 
8 0
3 years ago
Which of the following will lower blood pressure? Which of the following will lower blood pressure? angiotensin II atrial natriu
garik1379 [7]

Answer:

Angiotensin II atrial natriuretic peptide(ANP) lowers blood pressure.

Explanation:

Increase in plasma volume leads to increase in blood pressure and a decrease in plasma level also leads to a decrease in the blood pressure. ANP is an enzyme which stimulates the decrease in blood levels through certain factors thereby causing a decrease in the blood pressure.

Meanwhile ADH stimulates increase in blood plasma levels thereby increasing the blood pressure.

5 0
3 years ago
Read 2 more answers
Make a prediction as to how could the student increase the strength of the electromagnet using all of the materials listed and w
ivolga24 [154]
It would make the magnet way more strong
5 0
2 years ago
Read 2 more answers
Other questions:
  • The sporophyte generation produces spores that grow into a?
    6·1 answer
  • Portions of the genomes of certain prokaryotic species are very similar to portions of the genomes of distantly related prokaryo
    14·1 answer
  • A student notes that an individual has attached earlobes, a recessive trait in humans. A cell is taken from this individual, and
    8·1 answer
  • I need study tips for Biology?
    9·1 answer
  • A very acidic ph level is ______ , and very basic ph level is
    9·1 answer
  • How are dominant alleles often represented
    12·1 answer
  • Why is the third line of defense consider specific and adaptive
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Taxonomy is ________
    13·1 answer
  • Which technological tool helps earth scientists gain new knowledge about earth’s subsurface?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!