1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
3 years ago
15

What pair of molecules both contain carbon atoms

Biology
1 answer:
gtnhenbr [62]3 years ago
5 0

Answer:fats and proteins water and carbohydrates nucleic acids and water oxygen gas and fats Fats and proteins both contain carbon atoms. s

Explanation:

You might be interested in
Which of the following temperature scales is not regularly used in science?
Naddika [18.5K]
The answer is Fahrenheit because it doesn't convert well with the other two. thanks i hope this helps and please give me a brainiest answer i need four to advance to the next rank.
3 0
3 years ago
Read 2 more answers
What would your body be like if you did not have any bones
klasskru [66]
It would be a blob of muscle and veins
8 0
3 years ago
Read 2 more answers
Identify the phases of Meiosis II described below.
Annette [7]

1. The lining up of chromosomes by the spindle fibers takes place at metaphase II phase. It is the second stage of meiosis II, the spindle draws the chromosomes towards the metaphase plate.  

2. The formation of the nuclear envelope around each set of DNA takes place in telophase II. Along with the formation of the nuclear envelope, the process of cytokinesis also takes place in telophase II, producing four daughter cells, each comprising a haploid set of chromosomes.  

3. The sister chromatids are pulled apart in anaphase II stage. In this phase, the sister chromatids are migrated towards the opposite poles of the cell with the help of protein fibers.  

4. The centromeres are moved towards the poles of the cell at prophase II stage.  


8 0
3 years ago
Explain how cnidocytes with their nematocyst function in food capture and defense.
Darya [45]
It has a neurotic....which on hydric pressure....releases.....and paralise the prey......and thus able to eat or defense as well !
8 0
3 years ago
Why is the delayed filament synthesized discontinuously?
stiks02 [169]

Answer:

no

Explanation:

6 0
3 years ago
Other questions:
  • A mixture in which the suspended particles are too small to be seen with the naked eye is a _____. suspension
    9·2 answers
  • What is the process that darwin described as "descent with modification?
    9·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Discuss how the use of pedometers benefited people at high risk for type 2 diabetes. (site 1)
    10·2 answers
  • What plant is used to improve appearances
    12·2 answers
  • The accommodation of the very long DNA strands that are part of a chromosome into the limited space of the nucleus is achieved b
    5·1 answer
  • Electric charge drives this series of pumps and triggers known as eta reactions. What is the next effect of these reactions
    13·1 answer
  • Please help! thank you!!
    5·1 answer
  • New crust and hydrothermal vents forms at ridges formed at a ______________ boundary.
    10·1 answer
  • The shoulder blades are more ___ than the chest
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!