1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
2 years ago
9

What causes depersonalization of a nueron membrain potential?

Biology
1 answer:
zhuklara [117]2 years ago
4 0

Answer is, This voltage is called the resting membrane potential; it is caused by differences in the concentrations of ions inside and outside the cell. If the membrane were equally permeable to all ions, each type of ion would flow across the membrane and the system would reach equilibrium.

You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Can y’all help, please
lukranit [14]

third one

Explanation:

4 0
3 years ago
PLS HELP!! ASAP DUE TONIGHT!!
guapka [62]

Answer:

D. a higher number of double bonds between carbon atoms in their structures.

Explanation:

7 0
3 years ago
An animal’s __________ is an immediate automatic response to an external stimulus.
guajiro [1.7K]
It could be reflex or instinct, most likely reflex
7 0
3 years ago
Which specialized carbohydrate is used in shrimp exoskeletons?
otez555 [7]

Answer:

chitin

Explanation:

chitin is a complex carbohydrates, similar to cellulose, that makes up organic structure, such as the cell walls of fungi and exoskeletons of insects and other arthropods.

4 0
2 years ago
Other questions:
  • The species or which of these groups show neither wings nor antennae?
    13·1 answer
  • In negative regulation,
    7·1 answer
  • What compound is the human body unable to synthesize, but is essential in lowering blood pressure and blood levels of harmful li
    12·1 answer
  • In gymnosperms the mature seed in tucked inside
    14·1 answer
  • Mood disorders in which the disturbance lies in only one direction are considered
    15·1 answer
  • Explain how consuming an acid neutralizing antacid might affect protein digestion. Apply the concept of activation energy to sup
    6·2 answers
  • (WILL MARK BRAINLIEST AND 50pts) As the earth travels around the sun, the sun is always at one focus of an ellipse. What's at th
    8·1 answer
  • Polysaccharides have _____sugar(s); disaccharides have _____sugar(s); monosaccharides have _____sugar(s).
    13·2 answers
  • ___ is the only continent not to experience tornadoes. Africa Antarctica America
    13·2 answers
  • Which of the following would likely have the greatest range of pressure?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!