1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
crimeas [40]
3 years ago
13

Which part of a thunderstorm is the most threatening?

Biology
2 answers:
beks73 [17]3 years ago
5 0
Lightning I think. I don't understand the question
mihalych1998 [28]3 years ago
4 0
The lightning would be the most dangerous part of the storm because lightning can start forest fires and kill people by striking it. I hope this helped ^^
You might be interested in
Who has a larger vacule? plant cells or animal cells
Yanka [14]

Answer:

Plant Cells

Explanation:

Animal cells don't have a vacuole :)

3 0
3 years ago
Read 2 more answers
Can someone explain the 4th dimension to me the best you can?
lubasha [3.4K]
Th fourth dimension is time and the physical dimension has not yet been discovered
7 0
4 years ago
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
olchik [2.2K]

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

8 0
3 years ago
If a large molecule needs to move against the concentration gradient, what structure will need to be used ?
zubka84 [21]

Answer:

The structure of ATP will need to be used.

Explanation:

Adenosine triphosphate or ATP is an energy rich compound which undergo hydrolysis in presence of water to generate free energy.

         When a molecule is moving against its concentration gradient it requires the input of energy which is generally supplied by the hydrolysis of ATP molecules.

For example Na+K+ATPase uses the energy derived from ATP hydrolysis to transport Na+ inside the cell and K+ outside the cell.

8 0
3 years ago
Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell
weqwewe [10]
DNA is cytoplasmic (extranuclear) in Prokaryotes but intranuclear in Eukaryotes.
6 0
4 years ago
Read 2 more answers
Other questions:
  • In a changing environment, which organisms have an advantage—those that reproduce asexually or those that reproduce sexually? Ex
    6·1 answer
  • What does butterflies in the stomach mean reddit?
    8·1 answer
  • HELP ASAP!
    5·2 answers
  • Which of the organisms in the table is (are) most similar to a tiger (Panthera tigris)? Explain.
    7·1 answer
  • Which of the following best describe(s) the function of the 5' mRNA cap?
    7·1 answer
  • Would prescribing calcium salt helps to treat the primary bone problem in scurvy?​
    14·1 answer
  • What happens in the stomach?
    13·2 answers
  • How many chromosomes make us human?how many chromosomes do we get from each parents
    10·2 answers
  • Why is industrial society inherently unsustainable
    12·1 answer
  • Hdoaldnlsldmsldkjfjhsshxh
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!