1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorC [24]
3 years ago
9

Jeff subscribed to cable for 75.00 a month and 140.00 installation andrew has another cable co. For 20.00 installation and 90.00

a month. In how many months will we be paying the same amount for their service.? And what will be the amount they pay?
Mathematics
1 answer:
lilavasa [31]3 years ago
7 0
8 months; $740

75x+140=90x+20
Find x then plug it in to find the cost
You might be interested in
Kate uses 9.8 pints of white paint and blue paint to paint her bedroom walls. 3 4 of this amount is white paint, and the rest is
Natali [406]

Answer:

Blues Paints = 2.45 pints

Step-by-step explanation:

Let's generate an expression that would relate all the variables given:

Total pints of paints used:

9.8 = white + blue

Pints of white paint used:

= 3/4 of 9.8

=0.75 * 9.8

=7.35

Number of pint of BLUE PAINTS used:

9.8 = White Paints + Blue Paints

9.8 = 7.35 + Blue Paints

Blue Paints = 9.8 - 7.35

Blues Paints = 2.45

Kate used 2.45 pints Blues Paints for her bedroom

4 0
4 years ago
Help me ples!!!!!!!!!!!!!!!!!
bearhunter [10]
It would be subtraction I think
6 0
3 years ago
I need the value of x
Strike441 [17]

Answer:

x = 64°

Step-by-step explanation:

180° in half a circle or a line.

There is also 180° in a triangle.

So the other 2 angles of the triangle equal x.

34° + 30° = 64°

5 0
3 years ago
What property is (3x10)x8x(10x8)
mixer [17]

distributinve, multiplying from parenthesece

8 0
4 years ago
Read 2 more answers
Write the quadratic function in vertex form, then identify the vertex
34kurt

Answer:

vertex = (- 10, - 10 )

Step-by-step explanation:

The equation of a quadratic in vertex form is

y = a(x - h)² + k

where (h, k ) are the coordinates of the vertex and a is a multiplier

To obtain this form use the method of completing the square.

Given

h(x) = x² + 20x + 90

add/subtract ( half the coefficient of the x- term )²

h(x) = x² + 2(10)x + 100 - 100 + 90

      = (x + 10)² - 10 ← in vertex form

with (h, k ) = (- 10, - 10 )

8 0
3 years ago
Other questions:
  • The area of a rectangle is 16 square feet, determine the length and width if the legnth is 4 times the width
    8·1 answer
  • Which of the following adaptations will help a plant survive in a desert?
    13·2 answers
  • Part I On a certain university campus there is an infestation of Norway rats. It is estimated that the number of rats on campus
    7·1 answer
  • If the diameter of a circle is 19.3, what is the circumference?
    8·1 answer
  • Given triangle ABC, cos A = sqrt2 /3 find the exact value of side a
    10·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Which of the following is true given that 2.1 &lt; 2.8?
    7·2 answers
  • Marisol drove 3 hours from City A to City B. The equation below estimates the distance d, in
    6·1 answer
  • Use the expression in the accompanying discussion of sample size to find the size of each sample if you want to estimate the dif
    10·1 answer
  • A basket contains the following pieces of fruit: 3 apples, 4 oranges, 4 bananas, 2 pears, and 3 peaches. Jonas picks a fruit at
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!