1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Murljashka [212]
3 years ago
10

Describe two important ways that marine ecosystem impact the planet

Biology
1 answer:
Ronch [10]3 years ago
8 0
Animals eat marine creatures
we depend on water from marine ecosystems

You might be interested in
In which organism would photosynthesis not occur?
Ket [755]
It’s is heterotroph, hope this helps!
5 0
2 years ago
Are species in the same family more or less closely related than species in the same class?
katrin [286]
The classification is in this order: Kingdom, Phylum, Class, Order, Family, Genus Species. 
The kingdom is the largest group, it contains the largest number of organisms who are the least related.
The species is the smallest group, it contains the least number of organisms who are closely related.
As you go down, from "Kingdom", species become more closely related.
So species in the same family are MORE closely related than species in the same class.
4 0
3 years ago
Which would have more effect on the evolution of plants and animals?
S_A_V [24]

Answer:

E. onset of an ice age

Explanation:

8 0
2 years ago
Describe Two types of drugs and the negative impact the abuse of of these drugs can have on a person health
love history [14]

club drugs: lsd cause rapid heart rate

hallucinogens: bath salts causes hallucinations and can be dangerous to self and others

5 0
3 years ago
Read 2 more answers
Help!!! Earth Space Science important quiz so i can move on!!! Im stuck on 7 questions!!!
Illusion [34]

Outer core is the answer - Appex

3 0
3 years ago
Other questions:
  • Part 1 Imagine two cells. One is 10 microns long on each side and the other is 5 microns long on each side. Let’s say the job of
    11·1 answer
  • A doctor hypothesizes that a patient's digestive system is not properly secreting digestive enzymes. Which of the following woul
    11·2 answers
  • Cichlids are bony fish that are commonly found in the freshwater lakes of Africa, like Lake Victoria. There are more than 2000 r
    5·2 answers
  • Place the developments in evolutionary history in the proper time frame.
    6·1 answer
  • some people wrongly compare the cells inside the body with bricks in a wall.actually three are scores of difference between the
    13·1 answer
  • (b) The antibiotic streptomycin inhibits protein synthesis in bacteria. If this antibiotic is added to a culture of animal cells
    9·1 answer
  • Enzymes often
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • PLEASE HELP WHICH ARE THE ANSWERS FOR BOTH QUESTIONS!?!
    9·1 answer
  • Explain why temperature changes occur. <br> plz help
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!