Bottom of chain going up....
Deer Mouse, western toad, woodpecker, gray squirrel, Gopher snake, Mule deer, Cooper’s hawk, Cougar
Oh this is easy.
Astronomy is the branch
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Ribosomes, Cell membrane
Explanation:
Ribosomes can be described as structures which are involved in the production of proteins. Ribosomes are hence known to be the protein manufacturing units of a cell. As enzymes are also proteins,they will be synthesized in the ribosomes.
Cell membrane can be described as the membrane which is present outside the cell or which separates the cell from the external environment.
For an enzyme to pass through the external environment, it will have to pass through the ribosomes and the cell membrane.
