1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
15

ASAP!! sugars can be classified as which biomolecule?

Biology
1 answer:
Katarina [22]3 years ago
8 0
I think it’s D, carbohydrates.
You might be interested in
Why is it important for scientists to share results with others working in their field?
kap26 [50]
When they compare they can see the difference and similarities to get to the end result
5 0
4 years ago
Rocks , temperature , and water ARE what part of the environment
photoshop1234 [79]
The abiotic environment consists of non-living things. So, rocks, temperature and water are part of the abiotic environment.
7 0
3 years ago
Read 2 more answers
What produces egg and sperm cells during the life cycle of a plant?
Shtirlitz [24]
The haploid male (sperm) and female (egg<span>) sex </span>cells<span>; in </span>plants<span>, formed by mitosis of haploid </span>cells<span> in the gametophyte. ... The multicellular diploid portion of the </span>plant life cycle<span> resulting from the growth, mitosis, and </span>cell<span> division of a zygote. </span>Produces<span>sporangium that store haploid spores. Google*</span>
5 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Organic compounds always contain ____________________ atoms.
Naddik [55]

Answer: carbon and hydrogen

Explanation:

3 0
3 years ago
Other questions:
  • Explain the light-dependent and light-independent reactions that occur in photosynthesis. plz, help brainliest for best. not mul
    14·1 answer
  • The region of the abdominopelvic cavity that is inferior and medial to the left lumbar region is the:
    13·1 answer
  • What is the difference between biology and physics
    14·1 answer
  • Research suggests that high dietary intake of ________ by pregnant women may be related to higher iq levels among children.
    7·1 answer
  • Why do scientist publish their work
    15·1 answer
  • What are six different major levels of organization from smallest to largest that ecologists commonly study?
    9·1 answer
  • 11/13/2020
    8·1 answer
  • 14
    9·1 answer
  • The father of two children is type 0+, and the mother is type A+. The children are O- and A+.
    13·1 answer
  • The progressive change in the size of a skeletal muscle caused by destruction of motor neurons that activate it is called
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!