1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brut [27]
3 years ago
11

Messenger RNA travels from the _________ to the __________ delivering information from a strand of DNA.. A) cytoplasm, cell wall

. B) cytoplasm, nucleus. C) nucleus, cytoplasm. D) nucleus, cell wall . I
Biology
1 answer:
nirvana33 [79]3 years ago
4 0

Messenger RNA travels from the nucleus to the cytoplasm, delivering information from a strand of DNA. The correct answer between all the choices given is the third choice or letter C. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

You might be interested in
Microtubules have a variety of roles, which of the options below is NOT one of them?
klasskru [66]
The answer is the last one - construct the cell during cell division.
4 0
3 years ago
How do nutrients from food get into the blood?
jasenka [17]

Answer:

the answer is C

Explanation:

this shows how nutrients in the body because it enters the blood capillary which therefore goes through the small intestine.

I really hope this is helpful and understanding.

4 0
2 years ago
Read 2 more answers
Notice or perceive<br> e. Observe: <br> f. Infer:<br> g. Repetition:<br> h. Replication:<br> i. Data
Lelu [443]

Answer:

Try e. Observe for an answer

3 0
2 years ago
Why were cattle useful animals for farmers to domesticate?
Tamiku [17]

Some reasons:

→ They're cheap and common animals.

→ They can be either a source of meat, skin (leather) or milk.

→ Farmers benefit a lot with them, since what they produce are things of everyday consumption.

→ You don't need to spend much to be able to have them (mostly only with land).


Hope it helped,


BioTeacher101

7 0
3 years ago
Roger sperry conducted important research in what field of study?
icang [17]
Split-brain patients
6 0
3 years ago
Other questions:
  • Meiosis takes place in the of most organisms.
    11·2 answers
  • The founder principle explains how rare alleles and certain combinations of alleles may be enhanced in new
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Each transfer RNA requires at least four specific recognition sites that must be inherent in its tertiary structure in order for
    12·1 answer
  • Chad drew a diagram to compare animal cells and bacterial cells.
    13·2 answers
  • BRAINLIEST !!! + 15 points
    15·2 answers
  • An unlabeled hierarchical diagram of various astronomical bodies is shown. The labels A, B, C and D can be used to represent the
    12·1 answer
  • Look at the plant in the picture below to which of the following groups this plant belong to?
    8·1 answer
  • A frog that is native to the rainforests of Central America is a member of the genus agalychnis. This genus is part of the hylid
    10·1 answer
  • Which of the following is a WATER-SOLUBLE vitamin?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!