1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
2 years ago
9

Mark is a 25 year old sedentary male who weighs 250 pounds and is 6'0'. His RDA for protein is 90 grams (based on 0.8g/kg). He w

ants to gain muscle so he starts to lift weights. Which protein intake listed below would meet his needs now that he is strength training? (Choose the BEST answer.)
Biology
1 answer:
statuscvo [17]2 years ago
4 0

Answer:

Im jacked and I eat 90G Protein daily but I only weigh like 135 so if mark weighs 250 id say around 160-170g Protein for our buddy

Explanation:

You might be interested in
Give some examples of rocks that would be formed through the process depicted in the figure above.
asambeis [7]
Some examples would be slate, phyllite, and gneiss.
6 0
3 years ago
Read 2 more answers
How did this rock form?​
umka21 [38]

I would say fossilization

8 0
2 years ago
Read 2 more answers
Plants are the basis of nearly all ecosystems on Earth because they carry out the process of photosynthesis. Plants harvest ligh
Daniel [21]

Answer:

Trophic level

Consumer

Producer

Explanation:

All living organisms require energy for their life processes, which they obtain by taken in food. In an ecosystem, this food is derived when organisms feed on each other. This process that eventually leads to a flow of energy within organisms is called FOOD CHAIN.

A food chain or food web always begins with a unique set of organisms called PRODUCERS. Producers are autotrophs capable of harvesting light energy from the sun and use it to produce their food (chemical) in a process called PHOTOSYNTHESIS. Other organisms called HETEROTROPHS feed on these producers to derive energy. In ecology, they are called CONSUMERS. Other consumers feed on the previous ones also to get energy.

Hence, each step of the food chain is occupied by organisms that obtain and store energy by feeding on another organism. This step is called TROPHIC LEVEL.

In a nutshell, a PRODUCER (usually plants) starts the food chain/web due to its photosynthetic ability. This producer gets eaten by an organism called CONSUMER and in the process, the energy and nutrient stored in the producers flows to the consumer. Another consumers feeds on the previous one and the energy keeps flowing. Each step of the food chain occupied by an organism that stores and transfers this energy is called TROPHIC LEVEL.

4 0
3 years ago
The body sizes of sympatric and allopatric P. cinereus and P. hoffmani are consistent with a hypothesis of character displacemen
Genrish500 [490]

Answer:

Option C - The sympatric salamander populations evolved their present body sizes after they became sympatric.

Explanation:

First, note the definitions of each terms.

1) Sympatric occurs when organisms especially of same species occurring in the same, or in overlapping territory, do not interbreed.

2) Allopatric occurs when organisms are NOT living in the same territory and thus unable to crossbreed.

On 1st QUESTION

The argument would be strengthened by the failure of P. cinereus and P. hoffmani to crossbreed making traits for body size to become distinct (dissimilar) in each specie.

On 2nd QUESTION

Definitely, salamanders species occurring in the territory, do not interbreed after they became sympatric, thus, making characters among same species to be increasingly different over generations.

7 0
3 years ago
describe why red algae can grow at deeper deths when compared to other algal groups.Why is this an adaptive advantage?​
dybincka [34]

Red algae can grow at deeper depths when compared to other algal groups because they are adapted to absorb blue light, which is required for photosynthesis.

Explanation:

Red algae, also known as rhodophyta, usually occur in the depths of seas. This is because of a unique adaptation in their structures, due to the presence of phycoerythrin - a pigment that reflects light that is red, while equipping the algae to absorb blue light. Hence, the algae appears red in colour.

All plants (including algae) require sunlight to be able to synthesize their own food through the process of photosynthesis. For plants that live in the oceans, the sunlight penetrating the waters is the only source of radiation in this regard.

The blue light in the radiation spectrum has the characteristic features of having the highest energy, as well as the shortest wavelength. This makes it the most energetic section of light, enabling it to penetrate to the ocean depths.

The phyrcoerythrin in the red algae absorbs this blue light for photosynthesis. This process occurs even at depths upto 500 feet, hence becoming an adaptive advantage for red algae to be able to survive at greater depths.

5 0
3 years ago
Other questions:
  • Why is the new dna strand complementary to the 3' to 5' strands assembled in short segments? why is the new dna strand complemen
    8·1 answer
  • Fill in the blanks below to complete the hypothesis for this lab. It should answer the lab question, “What is the effect of mole
    11·2 answers
  • Producers found in the polar ice region
    8·1 answer
  • Suzanne has been having difficulty falling asleep and waking up in the morning. She has also noticed that her appetite has chang
    11·1 answer
  • HURRY NEED ASAP!
    12·2 answers
  • The outermost layer of the brain, the __________, is housed in the cerebrum.
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • This photograph shows a protion of the Monahans Sandhills in northwest Texas. Monahans Sandhills are noted for their sand dunes
    8·1 answer
  • ___ - in this type, the virus does not immediately kill the host cell.
    15·1 answer
  • PLEASE HURRY!!!!!!!!!!!!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!