1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirza4 [7]
3 years ago
8

If you have an idea to improve a complex software process at work, what is the most effective way to communicate this idea?

Biology
1 answer:
ludmilkaskok [199]3 years ago
7 0

Answer: Option D

Explanation:

If there is a certain idea regarding any process which can be improved then the thought to improve it should be first shared with the boss of the company.

Firstly, the person sharing the thought should himself be sure about the thought that he is going to present in front of the boss.

The thought regarding the improvement of the software process should be first written in an organized way and presented to the boss.

You might be interested in
Which of the following bones is not a facial bone?
Readme [11.4K]

Vomer bro OKAAAAAAAAAY

4 0
3 years ago
Flatworms crabs and starfish can all be classified as
Nataly_w [17]
They are classified as Invertebrates. 
Answer choice B. Invertebrates is correct.
Also here is a bit more information which is a list of invertebrate species..
<span>1. Clams,
</span>2. Squids,<span>
3. Crustaceans,
4. Arthropods,
</span><span>5. Insects,
</span><span>6. Worms,
7. Jellyfish,
</span>
I hope this helps!
6 0
2 years ago
Read 2 more answers
When you are inserting an oral airway, at which level of consciousness (alert, verbal, painful, or unconscious) should the patie
ICE Princess25 [194]
1. alert. 2. unconscious I think
8 0
3 years ago
Does crossing over happen in meiosis
Tamiku [17]
Yes, in the first stage. Prophase I
5 0
2 years ago
A lesion in _____ area of the brain would most likely result in a disruption of language comprehension and expression
Gnoma [55]
Wernicke's area would be the right answer.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Observations and measurements recorded during an experiment.
    10·1 answer
  • I dont understand my science work
    11·1 answer
  • Why do eukaryotic cells undergo mitosis?
    5·2 answers
  • Please help..<br> Thanks
    11·2 answers
  • Vertebrates developed about 550 million years ago. the oldest vertebrate fossils are those of _____ with no jaws.
    10·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is fudaa , where it is​
    10·1 answer
  • A new car is being built in a factory. One of the factory workers weighs all the parts before it is built. It weighs 2,300 pound
    8·1 answer
  • Which of the following is not a consequence of lack of conservation?
    6·1 answer
  • If two objects are moving at a constant speed with the same velocity, what will make the
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!