1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slavikrds [6]
3 years ago
13

The process shown in the diagram is called

Biology
2 answers:
leva [86]3 years ago
7 0

Answer:

The diagram has no problem

Explanation:

Exactly correct

Dmitry [639]3 years ago
7 0

Answer:

its transcription

Explanation:

You might be interested in
Art therapists should be excellent artists.<br><br><br> True<br> false
balandron [24]

Answer:

I think it's "True" sorry if I'm wrong

7 0
3 years ago
Please answer this question!!!
yaroslaw [1]

Answer:

b

Explanation:

7 0
4 years ago
Read 2 more answers
The circulatory system transports many important substances such as oxygen and nutrients. Which of the following
kupik [55]

Answer:

the answer is b. muscular walls of the arteries

Explanation:

3 0
3 years ago
Please help me i need this its due today 12/16/20 at 11pm and i have other work please (picture provided) and tell me if the con
valentinak56 [21]

Answer: I remember dong this back in October !  

Explanation:

Ok so boom....

Control -   Only mice near the radio

Independent - Amount of radio wave exposure

Experimental - Mice near the radio  

Dependent - Change in strength

Hope that helps

4 0
3 years ago
Cosmos episode 7
kirill [66]

During episode 7 of "Cosmos: A spacetime odyssey", Clare Patterson thanks the scientist who have come before him, among these, he mentions Charles Lyell and Michael Faraday.

Cosmos was a popular television science documentary series. Episode 7 titled "The Clean Room", explored the work of Clare Patterson and during said episode, as he awaits the sample from the spectrometer, Patterson proceeds to give thanks for the advancement of science by those who have come before him.

Patterson states that he wishes to give thanks to scientists who have come before him and proceeds to mention names such as:

  • J. J. Thomson.
  • Ernest Rutherford
  • Harrison Brown
  • Charles Lyell
  • Michael Faraday

all of which were renowned scientists with great contributions to the knowledge we possess today. He ends the thank you by stating that they now know the age of the Earth and with a symbolic "We did it."

To learn more visit:

brainly.com/question/1640558?referrer=searchResults

3 0
3 years ago
Other questions:
  • Different between dicotyledons and monocotyledons​
    15·1 answer
  • Triglycerides vary with respect to the number of ...
    8·1 answer
  • What is the function of the;
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Describe the production of an Action Potential in a post-synaptic neuron and its production of an AP in a neuron. Compare the pr
    8·1 answer
  • Can I get help with the cell structure and major cell types
    11·1 answer
  • What important function do bacteria in the soil have?
    15·2 answers
  • Explain vasodilation when to hot ?<br>​
    7·1 answer
  • Cellular respiration occurs in both plants and animals. why do plants need cellular respiration?
    13·1 answer
  • Which of the following is the site of translation?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!