1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dima020 [189]
3 years ago
7

Which of the following methods could be used to determine the influence of cell position on differentiation during embryological

development?
Biology
1 answer:
solmaris [256]3 years ago
5 0

Answer: Reverse the position of two cells from opposite poles as the blastula stage allow development

Explanation:

An experiment should be performed, this experiment will help to discover the interactivity that exists between cells before reaching the fetal period. The experiment ought to also influence the location of the cells.

You might be interested in
Which of the following best describes how amino acids affect the tertiary structure of a protein
yaroslaw [1]

Answer:

D

Explanation:

sorry if im to late

4 0
3 years ago
A way to build good credit is?
slava [35]

Answer: considering you are a college student as well, you can start off with signing up for a student credit card and have it pay monthly subscriptions of something payable such as spotify premium charges or netflix monthly subscritptions, something that you'll be able to pay back in order to build your credit score. I hope this helped

8 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Who is Charles darwin​
Sveta_85 [38]

Answer:

Charles Darwin came up with the theory of evolution.

7 0
3 years ago
Read 2 more answers
because ideas about evolution by natural selection have never been proven false what term can be used to describe evolution by n
Tanya [424]
The term that can be used to describe evolution by natural selection is SCIENTIFIC THEORY.

Theory means "the best explanation so far."

Scientific theory is a work in progress. It is a well-substantiated explanation of some aspect of the natural world that is acquired through the scientific method, and repeatedly confirmed through observation and experimentation.
8 0
3 years ago
Other questions:
  • The very rigorous medical program at a local university has a 10% drop out rate for each year. if the school admits 1,000 freshm
    14·1 answer
  • If two parents display distinct forms of a trait and all of their offspring (of which there are hundreds) display the same new f
    13·1 answer
  • 4-10 Assuming that the 30-nm chromatin fiber contains about 20 nucleosomes (200 bp/nucleosome) per 50 nm of length, calculate th
    13·1 answer
  • Which of these is not an environmental effect of deforestation?
    15·2 answers
  • Which of the following animals is successful because it moves quickly, reproduces rapidly, and has a waterproof external skeleto
    6·1 answer
  • What do enzymes to the rate of reaction
    13·1 answer
  • Villi are finger-like projections richly supplied with _____. They help in _____ in the small intestine.
    5·2 answers
  • The baker mixed yeast in the dough and kept it away for the night , The next morning it had risen high up , Explain how this hap
    11·1 answer
  • Question A.
    13·1 answer
  • Hemophilia is an example of
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!