1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galben [10]
3 years ago
15

What are the ramifications (pros and cons of introducing a natural predator of cane toads?

Biology
1 answer:
AlladinOne [14]3 years ago
5 0
I agree with the other presos
You might be interested in
Which is considered a single cell organism?
Katen [24]

Answer:

Hi! The answer is C: Bacteria! <3

Bacteria is a single celled microbe or in other words organism!

Hope this helped, if I was wrong please let me know! :3

3 0
3 years ago
two students are discussing natural selection in bacteria and how it can relate to antibiotic resistance in bacteria
shutvik [7]

Answer:

yes

Explanation:

some the bacteria are resistance to antibiotics due to mutation.

4 0
3 years ago
This leaf is an example of a plant organ<br> True<br> O False
Dafna11 [192]

Explanation:

true

..................

7 0
2 years ago
Read 2 more answers
In a deciduous forest ecosystem, which of these organisms would be a decomposer?
Lady bird [3.3K]
C- mushroom
Mushrooms break down (decompose) dead cells of animals and plants.

Algae, lichen, and oak trees go through photosynthesis and are producers.
5 0
3 years ago
Read 2 more answers
Where does transcription take place in the cell
bixtya [17]

In a prokaryotic cell, transcription and translation are coupled; that is, translation begins while the mRNA is still being synthesized. In a eukaryotic cell, transcription occurs in the nucleus, and translation occurs in the cytoplasm.

Hope This Helps!    Have A Nice Day!!

7 0
3 years ago
Other questions:
  • What is the name of the enzyme required in the 8th step of the citric acid cycle?
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Why must you include the water soluble vitamins in your daily diet?
    14·1 answer
  • How does the sun release energy
    14·2 answers
  • .Hemophilia is a sex-linked disorder that is caused by a defective gene on the X chromosome. What will be the pattern of inherit
    15·1 answer
  • Enzymes catalyze many important chemical reactions in the human body. Name one of these chemical reactions.
    13·1 answer
  • Witch of these is a characteristic of index fossils
    9·1 answer
  • what would happen if homogenisation and pasteurisation steps are omitted during the production of yoghurt
    13·1 answer
  • Scientists have determined that Earth's interior has layers with different properties. One property is that the inner core is so
    15·1 answer
  • Helpppppp me please
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!