1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lys-0071 [83]
3 years ago
8

What gets through transport proteins of the lipid bilayer easier? nonpolar or polar molecules? also, what other factors influenc

e it? does charge matter? any add. info appreciated. thanks.
Biology
1 answer:
Ksju [112]3 years ago
6 0
The cell membrane is selectively permeable and is a barrier to the movement of ions and molecules, particularly polar molecules such as glucose and amino acids that are repelled by the non-polar, hydrophobic lipids of the membrane. 

<span>Facilitated diffusion is the movment of a polar, charged substance by transport proteins from a region of higher concentration to a region of low concentration (down a concentration gradient) across a membrane with no direct use of energy. </span>

<span>The role of transport proteins is to facilitate diffusion of substances that are insoluble in the phospholipid bilayer by: </span>

<span>1) providing hydrophillic channels in the form of transmembrane channel proteins </span>

<span>2) acting as carrier proteins that carry the substance across the membrane via conformational change </span>

<span>Diffusion can occur through the channel in either direction. Transport proteins are also highly specific. </span>

<span>Channel Proteins have a fixed shape and are transmembrane proteins. They provide a hydrophillic channel across the membrane that is selective for a particular solute. Eg. water channel proteins (aquaporins) found in the cells lining collecting ducts in kidney allow water molecules to flow very quickly from one side of the membrane to the other. Some channel proteins function as gated channels, where a chemical or electrical stimulus will cause them to open or close. </span>

<span>Carrier Proteins are proteins which exists in two alternate conformations. They undergo rapid changes in shape when the molecule being transported binds to it. Thus moving a solute across the membrane as the shape of the protein changes. Eg. entry of glucose molecules into red blood cells. </span>

<span>Factors affecting facilitated diffusion include: </span>

<span>1) Concentration of substances </span>
<span>Transport proteins can take up substances from both sides of the membrane, but direction of flow depends on the relative concentrations of the substrate across the membrane. It also depends on the chance collision between transport protein and substrate. </span>

<span>2) Number of carriers/channel proteins </span>
<span>Increaseing the number of carriers will result in an increased rate of facilitated diffusion. </span>

<span>3) Number of substrate binding sites on the carrer </span>
<span>Increasing the number of binding sites will increase the rate of facilitated diffusion. </span>

<span>Another way to transport substances across the membrane is by active transport. This is the energy (ATP)-consuming transport of molecules or ions across a membrane against a concentration gradient via carrier proteins. </span>

<span>Active transport is a major factor in the ability of a cell to maintain internal concentrations of small molecules that differ from concentrations in its external environment. Movement is usually in one direction only (unlike diffusion which is reversible). Energy is required because in the substance is moved against its natural tendency to diffuse in the opposite direction. The energy supplied is ATP (andosine tri-phosphate) which is manufactured by the process of respiration. Active transport is achieved by carrier proteins situated in the cell membrane which need a supply of energy (ATP) to keep changing shape. </span>

<span>One type of carrier protein in the sodium-potassium pump (as mentioned by the answerer above). Since the cell expends energy when transporting the ions, it is also referred to as an ion pump. This transport system pumps ions against steep concentration gradients. The pump ocscillates between two conformational states in a pumping cycle that translocates 3 Na+ out of the cell for every 2 K+ pumped into the cell. ATP powers the changes in conformation by phosphorylating the transport protein. </span>

<span>Other mechanisms that transport substances into or out of a cell include diffusion, osmosis and bulk transport (endocytosis and exocytosis).</span>
You might be interested in
Describe why the amount of light available to the Chlorella culture might affect the growth dynamics of the alga.
-Dominant- [34]

Answer:

See the answer below

Explanation:

The amount of light available to Chlorella culture might affect the growth dynamics of the alga <u>because the light is an important factor necessary for the synthesis of carbohydrates and other important molecules in the body of the organism.</u>

The process of synthesizing carbohydrates is termed photosynthesis and during this process, the energy of light is used to excite the photosystem of the chlorophyll of the organism, leading to the release of electrons whose energy is used to synthesize an energy molecule that is utilized in the latter part of the photosynthetic process. The entire process of photosynthesis can be summarised as an equation below:

            6CO_2 + 6H_2O + light --> C_6H_1_2O_6 + 6O_2

<em>The manufactured carbohydrates act as food for the organism and are broken down during respiration to release energy necessary to drive metabolic processes that bring about growth and development.</em>

Hence, the amount of light is an important factor that might affect the growth dynamics of all green plants, including the Chlorella.  

5 0
3 years ago
Is Giardia viruses DNA or RNA viruses?
Nataliya [291]
RNA (: stranded RNA virus that infects specifically the parasitic protozoan G. lamblia. Among the many collected strains of G.
5 0
3 years ago
Why there is uncertainty in science.
andrew11 [14]

Answer: absolute certainty is often difficult to achieve. Scientific uncertainty generally means that there is a range of possible values within which the true value of the measurement lies.

Please brainliest

7 0
3 years ago
Please Help Due Soon!!
xeze [42]

Answer:

CBAD

Explanation:

7 0
3 years ago
The __________ the SA:V ratio of the cell, the _________ the materials can reach the center of the cell.
Mkey [24]

the higher the SA:V ratio of the cell the quicker the materials can reach the center of the cell

3 0
3 years ago
Other questions:
  • Kalie, age 18, is prescribed progesterone for the treatment of primary amenorrhea. which adverse effect would need to be reporte
    9·1 answer
  • Which organism is the producer in this food web?
    11·2 answers
  • A founding population of lizards arrives on an island. Which type of isolation would most likely result in this population becom
    7·2 answers
  • How do the two types of fermentation differ?
    6·2 answers
  • Which of the following scenarios would be an example of diffusion? A.when you inhale oxygen into your lungs,it is sent through y
    15·1 answer
  • in all plant and animal cells the nucleus contains long molecules of DNA which of the following best describes the function of t
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Hebdnenxndjwlsjdnejfnhcjrnfnfofnfjfnbfif
    10·1 answer
  • What materials make up the cell membrane
    7·2 answers
  • Which of the following is an example of a diploid cell?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!