1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
finlep [7]
3 years ago
10

Why has Europe conducted so much trade and exploration?

Geography
1 answer:
slamgirl [31]3 years ago
5 0
Do you have multiple choice to make it more specific
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Approximately what percent does central America contribute to the total amount of carbon dioxide produced in the world?
sertanlavr [38]
The answer is A. 0.5%
7 0
4 years ago
Read 2 more answers
Increasing Carbon Dioxide in the atmosphere, increases surface temperatures. True or False
Setler [38]

Answer:

I am pretty sure it is True

Explanation:

Can I please have a brainliest

7 0
3 years ago
What is quantitive spatial data? AP GEO
tiny-mole [99]

Answer:

hey mate here is ur answer

8 0
4 years ago
State four factors affecting vegetation​
taurus [48]

Answer:

Environmental factors that affect plant growth include light, temperature, water, humidity, and nutrition. It is important to understand how these factors affect plant growth and development

Explanation:

3 0
4 years ago
Read 2 more answers
Other questions:
  • Which statement best describes how igneous rocks are formed
    14·1 answer
  • Naturally occurring grasslands are usually found toward the interiors of continental masses. They tend to intergrade with ______
    14·1 answer
  • .
    5·1 answer
  • What is one theme that sets the modern era apart from previous time
    6·1 answer
  • Which of the following is not a boigenous sediment?
    13·1 answer
  • The waste fluid which is removed from the blood by kidneys is called ______
    7·2 answers
  • Explique por que a história da humanidade tem profundas raízes na Ásia.
    9·2 answers
  • Give me ur name and ill tell u what it means btw im not tryin to be creepy
    5·2 answers
  • In what country did the Industrial Revolution begin?
    5·1 answer
  • Tell me a joke..........................
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!