1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ludmilkaskok [199]
3 years ago
9

A scientist observes some cells under a compound microscope and needs to determine if they are bacteria or yeast. Aside from siz

e, what chemical compounds (not organelles!) would positively identify the cell as either a bacterium or a yeast?
Biology
2 answers:
Pie3 years ago
6 0

Answer:

Peptidoglycan and chitin.

Explanation:

Bacteria and yeast differ from each due to the different chemical composition of their cell wall.

Chitin: chitin is a large structural polysaccharide that is derived from chains of modified glucose. It is the primary components of cell wall in fungi such as yeast. Chitin is a minor component in the yeast cell wall, it accounts for only 1-2% of the cell wall dry mass. Chitin contributes to the mechanical strength of the cell wall.

Peptidoglycan: Peptidoglycan also known as murein is a polymer that makes up a the cell wall of a bacterium. It is composed of sugars and amino acids. A bacteria is a unicellular organism, therefore Peptidoglycan gives strength to the outer structure of the organism.

djyliett [7]3 years ago
5 0

Answer:

chitin and murein

Explanation:

The chemical compounds that distinguish bacteria cell from yeast cell are  

chitin and murein

Chitin is a polysaccharide present in the exoskeleton of fungi made up of chains of modified glucose known as N-acetylglucosamine. N-acetylglucosamine is derived from glucose

While murein is a mesh like structure made up of sugar and amino acids. Murein forms a layer outside the plasma membrane of bacterial cell.  

You might be interested in
Which of the following is an example of parasitism?
SpyIntel [72]

Answer:

Female mosquitoes feed on the blood of animals

Explanation:

6 0
3 years ago
Some human traits are controlled by more than two alleles this is called
VikaD [51]
Human traits controlled by multiple alleles are called multiple-allele traits. One widely known example is ABO blood type, which is controlled by 3 alleles.
7 0
3 years ago
Please help me:)
Lilit [14]

Answer:

ok

Explanation:

Continental drift was a theory that explained how continents shift position on Earth's surface. Set forth in 1912 by Alfred Wegener, a geophysicist and meteorologist, continental drift also explained why look-alike animal and plant fossils, and similar rock formations, are found on different continents. 

5 0
4 years ago
What tissue breaks down food for energy
Artist 52 [7]

Answer:

When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.

7 0
3 years ago
What type of consumer is a spider monkey
stiks02 [169]
I believe it is a secondary consumer
7 0
4 years ago
Other questions:
  • Avery started feeding her dog canned food two months ago. At first, when she opened the can of food, her dog was confused by the
    10·1 answer
  • Many sources of water pollution are found within the home. What actions can you take to reduce water pollution?
    10·1 answer
  • Which statement describes the difference between renewable and nonrenewable energy
    11·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Hi i was wondering what a strong CER would be for the following scientific question:
    15·1 answer
  • In facilitated diffusion, do molecules move down their concentration gradient? Explain.
    11·2 answers
  • List 5 basic structures of bacteria morphology.
    15·1 answer
  • How is density affected when the salinity increases?
    7·2 answers
  • What is the main trend shown in the graph?
    12·1 answer
  • If the dna sequence is TAC CCC AAG CTC GGT ATC. what is mRNA<br><br> tRNA<br><br> AA?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!