1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Art [367]
3 years ago
13

You are on the scene in the bad part of town for an unresponsive 18-year-old type 1 diabetic patient. his mother states that he

is very noncompliant with his diabetes management and goes unresponsive often due to low blood sugar. after performing the primary assessment, you believe that this is the most likely cause of his unresponsiveness. however, after taking a capillary glucose reading you are surprised to see that the patient's sugar level is normal. how will you now determine the field impression?
Biology
1 answer:
Margaret [11]3 years ago
8 0
<span>The answer would be: Continue patient care by getting a complete SAMPLE history and perform a complete secondary assessment.

If the reading of glucose test is normal, then you can exclude hypoglycemia from the possible diagnosis. Because the patient is accompanied by his mother, you can ask a brief history to exclude other possible diagnosis and complete secondary assessment before further help comes. The information would be beneficial to the healthcare personnel that will comes for help.
</span>
You might be interested in
These the flow of electrons (the current) and where some of the electrons' energy gets converted into heat.
Pavlova-9 [17]

Answer:

Insulators

Explanation:

The purpose of insulators are to convert the energy into thermal or heat energy

3 0
2 years ago
Do centralean diatoms have symmetry
IgorLugansk [536]
They have bilateral symmetry and a rounded shape. 

8 0
3 years ago
1. What term defines the ratio of the amount of water vapor actually in the air to the amount of water vapor that the air can ho
artcher [175]

Answer:

Relative humidity, RH

Explanation:

RH, is the ratio of the amount of water vapor present in the air to the maximum amount of water vapor needed for saturation at a certain pressure and temperature

4 0
2 years ago
Which of the following is the correct haploid number of chromosomes in humman?
Dima020 [189]

Answer: 23 chromosomes

In humans, gametes are haploid cells that contain 23 chromosomes, each of which a one of a chromosome pair that exists in diplod cells. The number of chromosomes in a single set is represented as n, which is also called the haploid number. In humans, n = 23.

HOPE THIS HELPS

4 0
3 years ago
Read 2 more answers
Five hundred million years ago, basaltic lava flowed in an area now known as Monticello, the historic home of Thomas Jefferson.
Slav-nsk [51]
I think, it’s option ( b ).
8 0
3 years ago
Read 2 more answers
Other questions:
  • based on the fact that people can get cancer regardless of their genetics, what are some things you can do to lower your risks o
    10·1 answer
  • What three factors are needed for natural selection to occur? (Check all that apply) 
    13·2 answers
  • Type of neuron that receives messages from the environment
    5·1 answer
  • Fever is an innate response to cellular injury and is initiated when pyrogens are released from damaged cells or certain bacteri
    5·1 answer
  • Which statement explains endosymbiosis theory?
    11·1 answer
  • How are proteins and nucleic acids related
    6·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Can someone help I don’t know
    9·1 answer
  • Which option describes adaptation?
    11·1 answer
  • Anyone wanna help me put all this info into paragraph form...:
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!