1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRINA_888 [86]
2 years ago
7

Will give brainliest to first correct answer. Explain how the superbug was created.

Biology
1 answer:
jolli1 [7]2 years ago
8 0

Answer:

A superbug refers to a germ that has formed resistance to multiple drugs that once treated the infection caused by the germ. The term “superbug” was developed by the media. While any germ may become a superbug, bacterial and fungal strains that routinely infect humans, animals, and crops are most likely to do so.

Superbugs are strains of bacteria that are resistant to several types of antibiotics. ... And the overuse and misuse of antibiotics helps to create drug-resistant bacteria. Here's how that might happen. When used properly, antibiotics can help destroy disease-causing bacteria.

You might be interested in
How does oxygen enters the blood and is transported to the cells
evablogger [386]
When you breath oxygen enters your body and gets transported to your blood cells
7 0
3 years ago
1. Which are the basic areas of life on earth?
jekas [21]
1)ocean
2)turning dark skin darker
3)tundra plant have a life span of only 1-2 month
4)it is rich with water and oxygen
5)planetary devastation All Mighty Push
4 0
2 years ago
The photograph shows soil layers in a grassland. the upper layer is a band of
ozzi

Answer: subsoil B

Explanation:

Don't really have one, I just know what it is!

8 0
3 years ago
Read 2 more answers
What is the phylum bacteria?
Dafna11 [192]
Phylum Bacteria are the major lineages(Known as Phyla or Divisions) of the domain bacteria.
5 0
3 years ago
Which one of the following does not have its outer orbit full?
gizmo_the_mogwai [7]

Answer:

Lithium

Explanation:

It is group I, not group 0.

7 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • ________ are enzyme used during replication to attach okazaki fragments to each other.
    13·1 answer
  • 1. Which of the following was Rudolf Virchow's contribution to our understanding of cells?
    6·2 answers
  • _____ is an area in the left frontal lobe of the brain that is involved in speech production
    13·1 answer
  • The American Heart Association recommends eating at least _______ ounces of oily fish per week to help reduce your risk of heart
    11·2 answers
  • Monarch butterflies have brightly colored orange wings with black patterns on them, making them easily visible to birds that eat
    15·2 answers
  • CAN I GET ANSWER OF 2 AND 4​
    15·1 answer
  • Help help please!!!!
    7·1 answer
  • There are some phylum including
    6·1 answer
  • What questions do you have about our origins? What clues in nature can we look for to investigate this mystery?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!