I think it is A . eubacteria
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Lytic infection is a kind of infection, which results in the bursting of a cell. During the lytic cycle, the infected cell and its membrane is being destructed. Therefore, during a lytic infection, the host cell is destroyed when it burst. The word lysis means the disintegration of a cell by rupture.
Answer: Affiliative behavior
Explanation:
Affiliative behavior is the behavior in which social interaction is seen between two animals through cohesion, meeting, hugging, involvement with each other, playful acts etc. They try to display emotional and social bond between them.
According to the question, chimpanzees displaying embracing behavior , ticking and little wresting shows that they have social and emotional link with each other.
Thus, they have affiliative behavior rather than aggressive and anger-based behavior.
They are more related to fish. 1. They both live in water. 2. Both are vertebrates. 3. Both have an internal skeleton.
