Answer:
One fertilizes the egg, and the other combines with the two polar nuclei.
Explanation:
Depending on the purpose for which the description is needed, there are three various levels of complexity at which the vascular architecture of the liver might be described:
- The first level, known as the conventional level, is equivalent to Couinaud's classic 8-segment scheme and serves as a common language for doctors from other disciplines to define the location of localized hepatic lesions.
- The true branching of the hepatic veins and the main portal pedicles is taken into consideration in the second, surgical level, which will be used for anatomical liver resections and transplantations. Modern surgical and radiological procedures may fully exploit this anatomy, but doing so involves acknowledging that the Couinaud scheme is oversimplified and examining the vascular architecture objectively.
- The third degree of complexity, known as the academic level, is focused on the anatomist and the requirement to provide a systematization that clarifies the apparent conflicts between anatomical literature, radiological imaging, and surgical practice.
To view more questions on Liver anatomy, refer to:
brainly.com/question/14600160
#SPJ4
Answer:
Heterozygous A: AO (remember, O type blood is a recessive allele. It's masked by A)
Heterozygous B: BB (h0m0zygous)
AO x BB --> AB, BO
Therefore, the genotypes of their offspring will be 1 AB to 1 BO, while the phenotypes will be 1 AB blood to 1 B blood.
I hope this answer helps you find what your looking for! :)
It should be
AGATACCATGGTTACCCGGTTCCA
Answer – Logos
If in an attempt to inform and
persuade her students not to experiment with illegal drugs, Whitney, a health
teacher explains the health risks of illegal drugs to them, she is using Logos artistic
proof. This is because, typical of logos artistic proof, she is citing facts
and statistics to persuade the students.