1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lidiya [134]
2 years ago
7

a point mutation occurs in a sex cell of an adult rabbit. The gene affected by the mutation is responsible for proteins that bui

ld heart muscles. Which describes the most likely effect or this mutation?
Biology
2 answers:
Alla [95]2 years ago
4 0

The rabbits offspring will not survive :

ahrayia [7]2 years ago
4 0

Answer:

Rabbit's offspring will die due to this mutation.

Explanation:

Mutations occur in sex cells or germ line cells are heritable and known as germline mutations. Sex cells produce gametes (sperm and ovum) and hence, mutation in these pass to the offspring.  When either a mutated ovum or sperm come together to form a single-cell zygote, each cell in developing zygote has that mutation.  

Thus, if a mutation affects the protein required for heart muscle in an adult rabbit, it will be pass to his offspring. The offspring will not be able to make functional proteins to build heart muscles and will die as heart is a vital organ.

You might be interested in
In the angiosperm life cycle, two sperm cells are discharged in each ovule. The reason that two sperm nuclei travel down the pol
blondinia [14]

Answer:

One fertilizes the egg, and the other combines with the two polar nuclei.

Explanation:

5 0
2 years ago
Anatomy of the liver: an outline with three levels of complexity--a further step towards tailored territorial liver resections.
QveST [7]

Depending on the purpose for which the description is needed, there are three various levels of complexity at which the vascular architecture of the liver might be described:

  • The first level, known as the conventional level, is equivalent to Couinaud's classic 8-segment scheme and serves as a common language for doctors from other disciplines to define the location of localized hepatic lesions.
  • The true branching of the hepatic veins and the main portal pedicles is taken into consideration in the second, surgical level, which will be used for anatomical liver resections and transplantations. Modern surgical and radiological procedures may fully exploit this anatomy, but doing so involves acknowledging that the Couinaud scheme is oversimplified and examining the vascular architecture objectively.
  • The third degree of complexity, known as the academic level, is focused on the anatomist and the requirement to provide a systematization that clarifies the apparent conflicts between anatomical literature, radiological imaging, and surgical practice.

To view more questions on Liver anatomy, refer to:

brainly.com/question/14600160

#SPJ4

5 0
1 year ago
A man heterozygous for blood type A marries a woman heterozygous for blood type B. What could be the possible blood types of the
GenaCL600 [577]

Answer:

Heterozygous A: AO (remember, O type blood is a recessive allele. It's masked by A)

Heterozygous B: BB (h0m0zygous)

AO x BB --> AB, BO

Therefore, the genotypes of their offspring will be 1 AB to 1 BO, while the phenotypes will be 1 AB blood to 1 B blood.

I hope this answer helps you find what your looking for! :)

5 0
3 years ago
Read 2 more answers
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
Whitney is a health teacher. she is attempting to inform and persuade her students not to experiment with illegal drugs. she doe
Sonja [21]

Answer – Logos

 

If in an attempt to inform and persuade her students not to experiment with illegal drugs, Whitney, a health teacher explains the health risks of illegal drugs to them, she is using Logos artistic proof. This is because, typical of logos artistic proof, she is citing facts and statistics to persuade the students.

4 0
3 years ago
Other questions:
  • When a cell undergoes mitosis, how many daughter cells are produced? Are they genetically identical or are they different. Why i
    9·1 answer
  • The advancement of science is always smooth and predictable process.
    7·2 answers
  • Based on the body structures of these animals, which two conclusions are scientifically sound?
    11·2 answers
  • What does prokaryote mean ?
    14·1 answer
  • Tay-Sachs disease is due to the absence of an enzyme that
    11·1 answer
  • ASAP The levels of water and salt in the blood are controlled by the ________, which is controlled by the ________.
    11·1 answer
  • How did research change during the period of classical biotechnology?
    11·1 answer
  • Identify the type of mutation that occurred and explain in what way it affected the protien
    6·1 answer
  • What is a possible pH of acid rain?<br> 07.0<br> 6.9<br> 04.3<br> 10.5
    11·2 answers
  • What is different between plant and animals
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!