Can you give me some more info
Answer:
The correct answer is D increasing the activity of protons pumps that lowers the pH of the cell walls allowing cells to elongate.
Explanation:
The plant growth hormone auxin work by increasing the H+ ion concentration thus decreasing the pH of the apoplast.
The decrease in the pH of the apoplast helps in the cell wall extension that ultimately result in cell growth.
Auxin hormone exert this effect by increasing the activity of increasing the activity of proton pumps in the apoplastic membrane.
Answer:
Population
Explanation:
A population may be defined as the group of organism of the same species. The main dynamics of population ecology are population density, immigration, emigration, birth rate and death rate.
A population should belong to a particular species that occupy the same area. The population can interbreed among themselves. Population ecology refers to the dynamics of population species.
Thus, the correct answer is option (3).
Your answer is 3. 4. 2. 1.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
