Answer:
hypha
mycelium
fruiting body
spores
Explanation:
<em>A typical fungi thallus includes many filamentous hypha that combine to form mycelium that grows underground, and produce a fruiting body reproductive structure that produce spores that disperse on the wind to new habitat.</em>
Fungi body are generally made up of hypha, a network of which forms the mycelium. The mycelium grows underground within the substrate and occasionally bring out fruiting bodies which bear the sporangium containing the spores. The spores act as agent of dispersal and are used to form new organisms when the conditions are right.
Photosynthesis is when plants use sunlight to synthesize food from carbon dioxide. Plants are autotrophs (they make their own food) and the food they synthesize creates carbohydrates, so the correct answer is D - autotrophs produce carbohydrates.
Hope this helps.
<u>Answer:</u>
<em>It is not true to say that common ancestors occurs only within a single species rather two species with similar traits might have a common ancestor. </em>
<u>Explanation:</u>
If the ancestor is same for both the species then it is said that both the species are closely related and share common ancestor with similar evolutionary relationship.
Phylogenetic tree are drawn and studies are done to understand the ancestor of a species. The evolution has occurred from the ancestor to the new species formed.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
