1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
3 years ago
13

Which type of RNA functions as a carrier of the genetic code?

Biology
1 answer:
gayaneshka [121]3 years ago
4 0

All forms of RNA are intermediate molecules that are fabricated within DNA to perform cellular functions.

mRNA - messenger RNA carries selected portions of DNA used to fabricate polypeptides used to fabricate amino acids for protein.

tRNA - transfer RNA is comprised of select genetic code and transfers amino acids to ribosomes for assembly

rRNA - ribosomal RNA is comprised of select genetic code and makes the ribosomes

RNA is highly mutatable, highly reactive, non-reproductive, and highly specialized metabolically, and consequently totally unsuitable for consideration of any pre-DNA senario being posited for the origin of life.

You might be interested in
The proposed kingdom Euglenozoa includes protists with one or two _____ emerging from an anterior pocket.
BigorU [14]
The proposed kingdom of euglenozoa includes protists with one or two flagella emerging from an anterior pocket
This flagella give them the ability to swim/moved throughout the water where they usually live

hope this helps

5 0
3 years ago
I need to turn this into a food chain, but after land plants there’s 2 so do I write both or just one?
frez [133]

Answer:

heron and perch or fox they are

8 0
2 years ago
What is the attractive force that occurs between the Sun and the Earth called?
cluponka [151]

Answer:

gravity

Explanation:

5 0
3 years ago
Read 2 more answers
Warning coloration is an example of what kind of behavior?
damaskus [11]
Its defensive, warning coloration is bright colors. Such as poisonous dart frogs, they are brightly colored in order to warn predators they are poisonous 
7 0
3 years ago
Read 2 more answers
7. Glucose molecules are the building blocks of what
Zepler [3.9K]

Answer:

Proteins and Carbohydrates

Explanation:

5 0
2 years ago
Other questions:
  • Ammonia can be produced by bacteria in the soil by two processes
    15·1 answer
  • 1. What type of response will a red blood cell have when placed in a hypertonic solution?
    5·1 answer
  • The internal framework or stroma of organs such as the spleen, liver, and lymph nodes is made up of ________ tissue.
    11·1 answer
  • How can a measure of density help identify a substance ???
    9·1 answer
  • Another One Free Brainlest
    6·2 answers
  • Summarize the key factors DNA polymerase requires to replicate DNA.
    8·1 answer
  • What system helps the digestive system move food until it becomes waste
    10·1 answer
  • Name:<br> Name:<br> 1.<br> Which of the following structures is not found in<br> bacteria?
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Illustrate and describe the energy_______ that occur during photosynthesis and respiration.​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!